Генетические полиморфизмы, ассоциированные с различной степенью выраженности преморбидных личностных аномалий у больных шизофренией

Авторы:
  • В. Е. Голимбет
    ФГБНУ «Научный центр психического здоровья», Москва, Россия
  • В. Г. Каледа
    ФГБНУ «Научный центр психического здоровья», Москва, Россия
  • Г. И. Коровайцева
    ФГБНУ «Научный центр психического здоровья», Москва, Россия
  • Т. В. Лежейко
    ФГБНУ «Научный центр психического здоровья», Москва, Россия
  • С. В. Каспаров
    ФГБНУ «Научный центр психического здоровья», Москва, Россия
  • Е. В. Крикова
    ФГБНУ «Научный центр психического здоровья», Москва, Россия
  • Д. В. Тихонов
    ФГБНУ «Научный центр психического здоровья», Москва, Россия
Журнал: Журнал неврологии и психиатрии им. С.С. Корсакова. 2019;119(3): 55-59
Просмотрено: 1281 Скачано: 131

Известно, что личностные особенности больных в доманифестном периоде шизофрении могут выступать в качестве факторов, влияющих на клинические проявления заболевания [1, 2], а генетические факторы вносят весомый вклад как в развитие шизофрении, так и в выраженность черт личности [3]. В литературе имеются сведения об ассоциации ряда генов-кандидатов шизофрении с преморбидным функционированием больных [4—6]. Есть основание предполагать, что на этапе, предшествующем заболеванию, влияние на выраженность конституционально-личностных черт оказывают гены, которые не связаны непосредственно с риском развития шизофрении, но могут модифицировать ее течение.

Цель настоящей работы — изучение ассоциации между генами, модифицирующими течение шизофрении, и выраженностью личностных аномалий в период, предшествующий манифестации психоза.

Выбор генов и полиморфизмов определялся наличием информации об их связи не столько с самим заболеванием, сколько с его клиническими проявлениями или чертами личности как у больных, так и у здоровых. На основании данных литературы и собственных исследований были выбраны полиморфные локусы 4 генов: рецептора серотонина типа 2а (полиморфизм Т102С), переносчика серотонина (полиморфизм 5-HTTLPR), нейротрофического фактора головного мозга (полиморфизм Val66Met) и С-реактивного белка (-717A>G).

Роль рецепторов серотонина типа 2а (5-HTR2A) в патогенезе шизофрении была установлена в исследованиях, проведенных как с использованием образцов аутопсийного мозга, так и в прижизненных нейровизуализационных исследованиях [7]. Молекулярно-генетические исследования позволили выявить ассоциацию с этим заболеванием нескольких полиморфных участков гена 5-HTR2A, в том числе полиморфизма Т102С [8], который оказался связан не только с самим заболеванием, но и с его клиническими проявлениями [9]. Кроме того, нами [10] была обнаружена связь этого полиморфизма с шизоидными чертами личности у психически здоровых людей. Полиморфизм 5-HTTLPR гена-переносчика серотонина не ассоциирован с шизофренией, но может оказывать модифицирующий эффект на особенности течения болезни [11, 12]. Нами была также показана его связь с шизоидными признаками у лиц из общей популяции [13]. Полиморфизм гена нейротрофического фактора головного мозга (BDNF) оказывает модифицирующий эффект на клинические проявления шизофрении, на что указывают результаты многих работ [14]. Интерес к гену, кодирующему С-реактивный белок (CRP), вызван тем, что содержание CRP связано с клиническими особенностями шизофрении, в частности с выраженностью негативных симптомов [15], также повышение этого маркера воспаления выявлено в группах высокого риска по шизофрении [16]. Однако связь между вариациями в гене CRP и шизофренией до сих пор не изучали. Следует отметить, что ранее нами [17] была обнаружена ассоциация между полиморфизмом CRP (-717A>G) и шизотипическими чертами личности.

В настоящем исследовании в отличие от работ, направленных на поиск ассоциации гена с преморбидным функционированием [4—6] и использующих количественную оценку конституционально-личностных черт с помощью соответствующих опросников и шкал, мы использовали категориальную оценку — разделение пациентов на группы в зависимости от выраженности аномалий личности. Такой подход, по мнению некоторых авторов [2], является более эффективным с точки зрения установления прогноза заболевания. Мы предположили, что с аномалиями личности будут связаны варианты полиморфных локусов выбранных генов, для которых ранее обнаружена ассоциация с выраженностью шизоидных черт личности или показателями неблагоприятного течения болезни, а именно: аллель С 5-HTR2A, аллель L переносчика серотонина, аллель Met BDNF, аллель G CRP.

Материал и методы

Обследовали больных, поступивших в клинику Отдела по изучению психических расстройств и аффективных состояний Научного центра психического здоровья.

Критерии включения больных в исследование следующие: 1) манифестация эндогенного приступообразного психоза в юношеском возрасте (16—25 лет); 2) наличие в первом психотическом приступе неконгруэнтных аффекту психотических расстройств; 3) начало заболевания в подростково-юношеском возрасте (12—25 лет). Критериями невключения являлись: 1) манифестация заболевания в возрасте до 16 и старше 25 лет; 2) наличие симптомов непрерывного течения заболевания; 3) сопутствующая психическая патология: органическое психическое расстройство, умственная отсталость; психические и поведенческие нарушения вследствие употребления психоактивных веществ, алкоголизма, наркомании; тяжелые соматические и инфекционные заболевания, нейроинфекции, эпилепсия, органические поражения ЦНС.

Выборка для исследования включала в себя 272 мужчины в возрасте от 18 до 45 лет, средний возраст составил 24,1 (5,9)​1​᠎ года, средний возраст больных к периоду манифестации заболевания — 20,9 (3,8) года. Всем пациентам был поставлен диагноз «шизофрения» (рубрика F20 по МКБ-10) или «шизоаффективное расстройство» (F25).

Основным методом исследования был клинико-психопатологический. Кроме того, выраженность симптомов шизофрении оценивали по шкале PANSS перед выпиской из стационара.

Больные были разделены на три группы. Принципы разделения были описаны ранее [18]. Для выделения групп был использован клинико-психопатологический метод, предусматривающий ретроспективный анализ данных анамнеза, полученных при опросе родственников и больных по мере редукции у них продуктивной симптоматики. Кроме того, качество преморбидного функционирования оценивали по шкале PAS (Premorbid Adjustment Scale), которая позволяет выявлять уровень социальной и учебно-трудовой адаптации, а также личностных взаимоотношений.

В 1-ю группу вошли 110 больных с минимально выраженными личностными аномалиями, которые не превышали верхние границы нормы (акцентуация характера). Ранний онтогенез и протекание пубертатного криза были нормальными. У больных из этой группы оценка по PAS соответствовала уровню преморбидного функционирования высокого качества. Инициальный этап заболевания чаще проявлялся аффективными расстройствами.

2-ю группу составили 113 пациентов, у которых отмечены личностные аномалии, оказывающие влияние на уровень адаптации во всех сферах деятельности, соответствующие критериям расстройства личности (F60 по МКБ-10). В период пубертата установлены многочисленные патологические эпизоды, ухудшающие социальную адаптацию. Оценка по PAS указывала на сомнительное качество преморбидного функционирования. Инициальный этап в большинстве случаев являлся продолжением патологически протекающего пубертатного криза.

В 3-ю группу вошли 49 больных с отчетливо выраженными аномалиями, сходными с субклиническими проявлениями шизофрении. Течение пубертатного криза оценено как патологическое у всех больных. Уровень преморбидного функционирования соответствовал «стабильно неудовлетворительному». Инициальный этап чаще характеризовался преобладанием негативных и неврозоподобных проявлений. Негативные расстройства были представлены аутистическими изменениями личности и признаками социальной дезадаптации.

Молекулярно-генетическое исследование заключалось в выделении ДНК с использованием фенол-хлороформной экстракции. Генотипирование проводили с помощью полимеразной цепной реакции (ПЦР) с использованием стандартных олигонуклеотидных праймеров (ООО «Синтол», Россия) и условий амплификации. Полученные ПЦР продукты инкубировали в течение ночи при 37 °C с ферментами рестрикции (ООО «Сибэнзим», Россия) и разделяли методом электрофореза в 8% полиакриламидном геле. Полиморфизм 5-HTTLPR, обусловленный различным числом повторяющихся последовательностей ДНК, исследовали без обработки ферментами рестрикции. На электрофореграмме он был представлен тремя вариантами (генотипами): LL (фрагмент 529 пар оснований — п.о.), LS (фрагменты 529 и 486 п.о.) и SS (фрагмент 486 п.о.). Для полиморфизма Val66Met BDNF полученную в результате ПЦР последовательность ДНК длиной 113 п.о. инкубировали с рестриктазой PcpCI. Полиморфизм представлен тремя вариантами (генотипами): MetMet (на электрофореграмме соответствует фрагменту длиной 113 п.о.), ValVal (фрагменты длиной 78 и 35 п.о.) и ValMet (фрагменты длиной 113, 78 и 35 п.о.). Для полиморфизма 5-HTR2А Т102С полученную в результате ПЦР последовательность ДНК длиной 372 п.о. инкубировали с рестриктазой MspI при 37 °C. Полиморфизму соответствуют фрагменты 372 п. (генотип ТТ), 372, 216 и 156 п.о. (генотип ТС) и 216 и 156 п.о. (генотип СС). Генотипирование по полиморфизму CRP -717A>G (rs2794521) проводили методом ПЦР в реальном времени с использованием флюоресцентно-меченных проб при условиях: 94 °C, 1 мин, 35 циклов (94 °C — 10 с; 60 °C — 20 с). Применяли следующие последовательности олигонуклеотидных праймеров и проб: CCTTCCTGTGTCCAAGTA (прямой), GAGAGTTCTTAATAAGTGTACTCAA (обратный), пробы R6G-CCAAACACCGCGTGTTCTCACTCA-BHQ2, ROX-CCAAACACCGCATGTTCTCACTCA-BHQ2.

После генотипирования в общей группе была проведена проверка на соответствие распределения генотипов закону Харди—Вайнберга. Отклонений не обнаружено ни для одного из полиморфных локусов.

При анализе данных оценивали значимость межгрупповых различий в частоте генетических вариантов с помощью критерия χ2 Пирсона. Попарные различия оценивали с помощью точного критерия Фишера. Риск рассчитывали, используя показатель отношение шансов (ОШ) с приведением доверительного интервала при вероятности 95% (95% ДИ). Различия в выраженности количественных признаков определяли с помощью критерия Стьюдента (t), поскольку распределение исследуемых данных (возраст, баллы шкал PANSS) соответствовало нормальному. Поправку на множественность сравнений не вводили, поскольку анализ проводили в соответствии с выдвинутой гипотезой.

Исследование было одобрено этическим комитетом Научного центра психического здоровья. Все участники подписали информированное согласие на участие в нем.

Результаты и обсуждение

При оценке выраженности симптомов по шкале PANSS в каждой из групп были выявлены существенные различия между ними (табл. 1).

Таблица 1. Клиническая характеристика выделенных групп больных
1-я группа отличалась от 2-й группы меньшей выраженностью негативных и общих психопатологических симптомов, а по сравнению с 3-й группой наряду с меньшей выраженностью указанных симптомов отмечен более поздний возраст манифестации психоза. Различия между 2-й и 3-й группами наблюдали только в отношении возраста больных (больные 3-й группы были моложе) и возраста пациентов в период манифестации заболевания (в 3-й группе он был меньше). Выраженность позитивных симптомов была сходной во всех группах.

Распределение частоты генотипов по полиморфному локусу 5-HTR2A T102C различалось между 1-й и 2-й группой (χ2=6,6, df=2, p=0,037). Попарное сравнение выявило различия между генотипами СС и ТТ, при этом частота генотипа СС была выше во 2-й группе (p=0,012; ОШ 2,7; ДИ 1,3—5,9). Также значимые различия были обнаружены между 1-й и 3-й группой (χ2=13,6, df=2, p=0,001). Попарное сравнение выявило различия между генотипами СС и ТТ (p=0,002; ОШ 5,2; ДИ 1,7—15,5) и генотипами СС и ТС (р=0,004; ОШ 3,2; ДИ 1,5—6,9), в обоих случаях частота генотипа СС была выше в 3-й группе по сравнению с 1-й группой. Значимых различий в распределении частоты генотипов между 2-й и 3-й группой не обнаружено.

Частота исследуемых генотипов в группах с различной выраженностью аномалий личности представлена в табл. 2.

Таблица 2. Частота исследуемых генотипов в выделенных группах больных Примечание. * — р<0,05; ** — р=0,01.
Распределение частоты генотипов по полиморфизму 5-HTTLPR гена-переносчика серотонина различалось между 1-й и 2-й группой (χ2=7,3, df=2, p=0,025). При попарном сравнении оказалось, что различия значимы только между генотипами LL и LS (р=0,01; ОШ 2,4; ДИ 1,3—4,5), при этом частота генотипа LL была выше во 2-й группе. При объединении генотипов LS и SS и сравнении их частоты с частотой генотипа LL различия были значимы (р=0,015; ОШ 2,1; ДИ 1,1—3,8). Сравнение частоты генотипов в 1-й и 3-й группах также выявило различия (χ2=8,1, df=2, p=0,017). В 3-й группе частота генотипа LL была выше частоты генотипа LS (р=0,008; ОШ 3,0; ДИ 1,4—6,5), различия между генотипами LL и SS наблюдали на уровне тенденции (р=0,08). При объединении генотипов, содержащих аллель S, различия достигали уровня значимости (р=0,006; ОШ 2,9; ДИ 1,4—5,9). Не выявлено значимых различий в распределении частоты генотипов между 2-й и 3-й группой.

Для полиморфизма BDNF Val66Met установлено, что редкий генотип MetMet отсутствует в 1-й и 2-й группах, а частота его в 3-й группе составляет 5,3%, при этом различия значимы в сравнении как с 1-й группой (χ2=7,7, df=2, p=0,02), так и со 2-й группой (χ2=9,7, df=2, p=0,008). Попарный анализ выявил, что в 3-й группе относительно 1-й группы частота генотипа MetMet выше, чем ValVal (p=003; ОШ 15,4; ДИ 0,7—307,9), и ниже, чем ValMet (р=0,01; ОШ 21,6; ДИ 0,7—455,0). Аналогичные различия отмечены между 3-й и 2-й группой (р=0,04; ОШ 14,3; ДИ 0,7—284,6 и р=0,01; ОШ 27,0; ДИ 1,3—564,8 соответственно).

Для полиморфизма CRP -717A>G значимых различий в распределении частоты генотипов между группами не выявлено. В 3-й группе отмечено повышение частоты генотипов, содержащих аллель G, однако различия наблюдали на уровне тенденции (р=0,08).

Таким образом, в соответствии с выдвинутым предположением были обнаружены различия в частоте генотипов в группах больных шизофренией, различающихся выраженностью личностных аномалий. В 3-й группе более часто встречались варианты трех генов: генотип СС (5-HTR2A T102C), генотип LL (5-HTTLPR) и генотип MetMet (BDNF Val66Met). Оценка О.Ш. показала, что у носителей генотипа СС (5-HTR2A T102C) шанс развития выраженных аномалий личности на этапе, предшествующем манифестации психоза, в 3—5 раз выше, чем у носителей генотипов, содержащих аллель Т; у носителей генотипа LL (5-HTTLPR) он выше примерно в 3 раза по сравнению с носителями аллеля S, а у носителей генотипа MetMet (BDNF Val66Met) — в 15 раз по сравнению с носителями аллеля Val. Клинические характеристики групп указывают на более неблагоприятное течение заболевания в 3-й группе по сравнению с другими группами. Этот факт можно рассматривать в качестве косвенного свидетельства того, что перечисленные выше генетические варианты повышают не только риск личностных аномалий, но и риск наименее благоприятного течения болезни. Данные литературы подтверждают это предположение. Так, неоднократно сообщалось о связи генотипа СС с неблагоприятным течением шизофрении (хроническое течение, более ранний возраст манифестации [19—21]. По данным наших собственных исследований, частота генотипа LL коррелировала с выраженностью позитивных и негативных симптомов при сравнении групп больных шизофренией с аффективным синдромом и без него [12]. При исследовании полиморфизма BDNF Val66Met у больных шизофренией показано, что аллель Met связан с большей выраженностью нейрокогнитивного дефицита, причем ассоциация отмечена только у мужчин [22], а также с выраженностью негативных симптомов [23, 24].

Полученные результаты позволяют прийти к заключению, что полиморфные локусы 5-HTR2A T102C, 5-HTTLPR, BDNF Val66Met, которые, как показали более ранние исследования, оказывают модифицирующий эффект на клинические особенности шизофрении, связаны также и с выраженностью конституционально-личностных черт больных в период, предшествующий заболеванию.

Следует отметить, что исследование имело ряд ограничений: 1) относительно небольшая численность групп, в особенности группы с высокой выраженностью личностных аномалий, так как сложность набора этой группы была связана с трудностью разграничения стадии преморбида и начальных проявлений шизофренического процесса; 2) включение в исследуемые группы только мужчин; 3) использование ретроспективного метода для оценки преморбидных личностных аномалий у больных шизофренией. С учетом указанных ограничений продолжение исследований в этом направлении позволит выявить генетические варианты, связанные с прогнозом течения шизофрении, уже на доманифестной стадии заболевания.

Исследование выполнено при финансовой поддержке РФФИ в рамках научного проекта № 17−29−02088.

Авторы заявляют об отсутствии конфликта интересов.

Сведения об авторах

Голимбет Вера Евгеньевна — д.б.н., зав.лаб. ФГБНУ НЦПЗ; e-mail: golimbet@mail.ru; https://orcid.org/0000-0002-9960-7114

Каледа Василий Глебович — д.м.н., зав.отделом ФГБНУ НЦПЗ; e-mail: kaleda-vg@yandex.ru; https://orcid.org/0000-0002-1209-1443

Коровайцева Галина Ивановна — к.б.н., в.н.с. ФГБНУ НЦПЗ; e-mail: korovaitseva@mail.ru; https://orcid.org/0000-0001-7653-4242

Лежейко Татьяна Викторовна — к.б.н., с.н.с. ФГБНУ НЦПЗ; e-mail: lezheiko@list.ru; https://orcid.org/0000-0002-7873-2039

Каспаров Станислав Викторович — к.б.н., с.н.с. ФГБНУ НЦПЗ; e-mail: vorapsak@mail.ru

Крикова Екатерина Владимировна — к.б.н., с.н.с. ФГБНУ НЦПЗ; e-mail: katya.krikova.83@mail.ru

Тихонов Денис Витальевич — м.н.с. ФГБНУ НЦПЗ; e-mail: denvt@list.ru

*e-mail: golimbet@mail.ru

1Здесь и далее в скобках указано стандартное отклонение.

Список литературы:

  1. Campos MS, Garcia-Jalon E, Gilleen JK, David AS, Peralta VM, Cuesta MJ. Premorbid personality and insight in first-episode psychosis. Schizophr Bull. 2011;37(1):52-60. https://doi.org/10.1093/schbul/sbq119
  2. Ridgewell C, Blackford JU, McHugo M, Heckers S. Personality traits predicting quality of life and overall functioning in schizophrenia. Schizophr Res. 2017;182:19-23. https://doi.org/10.1016/j.schres.2016.10.007
  3. Polderman TJ, Benyamin B, de Leeuw CA, Sullivan PF, van Bochoven A, Visscher PM, Posthuma D. Meta-analysis of the heritability of human traits based on fifty years of twin studies. Nat Genet. 2015;47(7):702-709. https://doi.org/10.1038/ng.3285
  4. Addington AM, Gornick M, Sporn AL, Gogtay N, Greenstein D, Lenane M, Gochman P, Baker N, Balkissoon R, Vakkalanka RK, Weinberger DR, Straub RE, Rapoport JL. Polymorphisms in the 13q33.2 gene G72/G30 are associated with childhood-onset schizophrenia and psychosis not otherwise specified. Biol Psychiatry. 2004;55(10):976-980. https://doi.org/10.1016/j.biopsych.2004.01.024
  5. Gornick MC, Addington AM, Sporn A, Gogtay N, Greenstein D, Lenane M, Gochman P, Ordonez A, Balkissoon R, Vakkalanka R, Weinberger DR, Rapoport JL, Straub RE. Dysbindin (DTNBP1, 6p22.3) is associated with childhood-onset psychosis and endophenotypes measured by the Premorbid Adjustment Scale (PAS). J Autism Dev Disord. 2005;35(6):831-838. https://doi.org/10.1007/s10803-005-0028-3
  6. Walshe M, Vassos E, Picchioni M, Shaikh M, Toulopoulou T, Collier D, McDonald C, Murray R, Bramon E. The Association between COMT, BDNF, and NRG1 and Premorbid Social Functioning in Patients with Psychosis, Their Relatives, and Controls. Scientifica (Cairo). 2012;2:560514. https://doi.org/10.6064/2012/560514
  7. Selvaraj S, Arnone D, Cappai A, Howes O. Alterations in the serotonin system in schizophrenia: a systematic review and meta-analysis of postmortem and molecular imaging studies. Neurosci Biobehav Rev. 2014;45:233-245. https://doi.org/10.1016/j.neubiorev.2014.06.005
  8. Abdolmaleky HM, Faraone SV, Glatt SJ, Tsuang MT. Meta-analysis of association between the T102C polymorphism of the 5HT2a receptor gene and schizophrenia. Schizophr Res. 2004;67(1):53-62. https://doi.org/10.1016/S0920-9964(03)00183-X
  9. Ni J, Lu W, Wu Z, Chen J, Yi Z, Zhang C. T102C polymorphism of serotonin 2A type receptor gene confers susceptibility to (early onset) schizophrenia in Han Chinese: an association study and meta-analysis. Asia Pac Psychiatry. 2013;5(1):24-30. https://doi.org/10.1111/appy.12027
  10. Митюшина Н.Г., Алфимова М.В., Ляшенко Г.Л., Асанов А.Ю., Голимбет В.Е. Полиморфизм гена серотонинового рецептора 5-HTR2A и шизотипические признаки у психически здоровых лиц. Журнал неврологии и психиатрии им. С.С. Корсакова. 2003;103(11):53-57.
  11. Goldberg TE, Kotov R, Lee AT, Gregersen PK, Lencz T, Bromet E, Malhotra AK. The serotonin transporter gene and disease modification in psychosis: evidence for systematic differences in allelic directionality at the 5-HTTLPR locus. Schizophr Res. 2009;111(1-3):103-108. https://doi.org/10.1016/j.schres.2009.03.021
  12. Golimbet V, Korovaitseva G, Lezheiko T, Abramova LI, Kaleda VG. The serotonin transporter gene 5-HTTLPR polymorphism is associated with affective psychoses but not with schizophrenia: A large-scale study in the Russian population. J Affect Disord. 2017;208:604-609. https://doi.org/10.1016/j.jad.2016.10.020
  13. Голимбет В.Е., Алфимова М.В., Коровайцева Г.И., Лаврушина О.М., Лежейко Т.В., Уварова Л.Г., Ляшенко Г.Л. Новые доказательства в пользу связи гена переносчика серотонина с шизотипическими признаками. Журнал неврологии и психиатрии им. С.С. Корсакова. 2009;109(5):43-47.
  14. Notaras M, Hill R, van den Buuse M. A role for the BDNF gene Val66Met polymorphism in schizophrenia? A comprehensive review. Neurosci Biobehav Rev. 2015;51:15-30. https://doi.org/10.1016/j.neubiorev.2014.12.016
  15. Boozalis T, Teixeira AL, Cho RY, Okusaga O. C-Reactive Protein Correlates with Negative Symptoms in Patients with Schizophrenia. Front Public Health. 2018;5:360. https://doi.org/10.3389/fpubh.2017.00360
  16. Щербакова И.В., Козловская Г.В., Калинина М.А., Клюшник Т.П. Состояние врожденного и приобретенного иммунитета у детей из группы высокого риска возникновения шизофрении и больных шизофренией детей. Журнал неврологии и психиатрии им. С.С. Корсакова. 2005;105(11):45-49.
  17. Алфимова М.В., Голимбет В.Е., Лежейко Т.В., Кондратьев Н.В. Ассоциация полиморфизма -717A>G гена С-реактивного белка (CRP) с шизотипическими чертами личности. Бюллетень экспериментальной биологии и медицины. 2016;162(7):99-101. https://doi.org/10.1007/s10517-016-3552-6
  18. Мелешко Т.К., Критская В.П., Сергеева О.Е., Каледа В.Г. Первый психотический приступ в юношеском возрасте: особенности личности и когнитивной деятельности больных. Журнал неврологии и психиатрии им. C.C. Корсакова. 2013;113(11-1):10-16.
  19. Joober R, Benkelfat C, Brisebois K, Toulouse A, Turecki G, Lal S, Bloom D, Labelle A, Lalonde P, Fortin D, Alda M, Palmour R, Rouleau GA. T102C polymorphism in the 5HT2A gene and schizophrenia: relation to phenotype and drug response variability. J Psychiatry Neurosci. 1999;24(2):141-146.
  20. Segman RH, Heresco-Levy U, Finkel B, Goltser T, Shalem R, Schlafman M, Dorevitch A, Yakir A, Greenberg D, Lerner A, Lerer B. Association between the serotonin 2A receptor gene and tardive dyskinesia in chronic schizophrenia. Mol Psychiatry. 2001;6(2):225-229. https://doi.org/10.1038/sj.mp.4000842
  21. Голимбет В.Е., Каледа В.Г., Алфимова М.В., Коровайцева Г.И., Лаврушина О.М., Бархатова А.Н., Каспаров С.В., Иванова Н.В. Молекулярно-генетическое исследование эндогенных приступообразных психозов, манифестирующих в юношеском возрасте. Журнал неврологии и психиатрии им. С.С. Корсакова. 2007;107(8):49-54.
  22. Golimbet VE, Alfimova MV, Korovaĭtseva GI, Lezheĭko TV. Modulating effect of Val66Met polymorphism of brain-derived neurotrophic factor gene on clinical and psychological characteristics of patients with schizophrenia. Mol Biol (Mosk). 2014;48(1):69-74. https://doi.org/10.1134/s0026893314010038
  23. Mezquida G, Penadés R, Cabrera B, Savulich G, Lobo A, González-Pinto A, Penzol MJ, Corripio I, Fernandez-Egea E, Gassó P, Cuesta MJ, Bernardo M. PEPs group. Association of the brain-derived neurotrophic factor Val66Met polymorphism with negative symptoms severity, but not cognitive function, in first-episode schizophrenia spectrum disorders. Eur Psychiatry. 2016;38:61-69. https://doi.org/10.1016/j.eurpsy.2016.04.011
  24. Notaras MJ, Hill RA, Gogos JA, van den Buuse M. BDNF Val66Met Genotype Interacts With a History of Simulated Stress Exposure to Regulate Sensorimotor Gating and Startle Reactivity. Schizophrenia Bulletin. 2017;43(3):665-672. https://doi.org/10.1093/schbul/sbw077