Левченко О.К.

ФГБУ «Национальный медицинский исследовательский центр гематологии» Минздрава России

Пшеничникова О.С.

ФГБУ «Национальный медицинский исследовательский центр гематологии» Минздрава России

Сурин В.Л.

ФГБУ «Национальный медицинский исследовательский центр гематологии» Минздрава России

Полянская Т.Ю.

ФГБУ «Национальный медицинский исследовательский центр гематологии» Минздрава России

Зоренко В.Ю.

ФГБУ «Национальный медицинский исследовательский центр гематологии» Минздрава России

Галстян Г.М.

ФГБУ «Национальный медицинский исследовательский центр гематологии» Минздрава России

Савченко В.Г.

ФГБУ «Национальный медицинский исследовательский центр гематологии» Минздрава России

Изучение генетических и фенотипических маркеров боли у пациентов с гемофилией

Журнал: Российский журнал боли. 2020;18(3): 25-38

Просмотров : 20

Загрузок :

Как цитировать

Левченко О.К., Пшеничникова О.С., Сурин В.Л., Полянская Т.Ю., Зоренко В.Ю., Галстян Г.М., Савченко В.Г. Изучение генетических и фенотипических маркеров боли у пациентов с гемофилией. Российский журнал боли. 2020;18(3):25-38. https://doi.org/10.17116/pain20201803125

Авторы:

Левченко О.К.

ФГБУ «Национальный медицинский исследовательский центр гематологии» Минздрава России

Все авторы (7)

От боли в суставах на протяжении всей жизни страдает большинство пациентов с тяжелой формой гемофилии [1, 2]. Вынужденное применение различных анальгетических препаратов у этой категории больных приводит к осложнениям. Использование нестероидных противовоспалительных препаратов приводит к поражению слизистой желудка, дезагрегации тромбоцитов и повторным кровотечениям, которые способствуют разрушению нормальных тканей и развитию деформирующих артрозов. Многие больные гемофилией, у которых заболевание протекает с интенсивной болью, принимают наркотические анальгетики [3, 4]. Длительное употребление опиоидов приводит к повышению болевой чувствительности, возникновению опиоидно-индуцированной гипералгезии.

Индивидуальные различия болевого ответа используются в качестве инструмента исследования ноцицептивных механизмов и рассматриваются как основа для персонализированного подхода к боли. Множество факторов, модулирующих боль, предполагает сравнительную оценку их влияния на восприятие боли. Значительный вклад в индивидуальные различия болевой чувствительности вносят генетические факторы [5]. Ассоциации между функцио-нальными полиморфизмами и различными видами боли выявлены для многих генов, на основании чего создана база данных со сводной таблицей взаимосвязей (https://humanpaingenetics.org/hpgdb/).

Показано, что некоторые генетические варианты изменяют возникновение, передачу и обработку ноцицептивной информации или местную доступность активных анальгетиков и их фармакодинамический эффект. Каждый отдельно взятый генетический вариант оказывает умеренное действие на восприятие боли, однако в совокупности они формируют разнообразие степени болевой чувствительности в мировой популяции [6]. Ассоциации с хронической послеоперационной болью и с различиями в потребности в опиоидах чаще всего отмечают для генов COMT, OPRM1 и SCN9A [7—12].

Ген SCN9A, расположенный в локусе второй хромосомы 2q24.3, кодирует альфа-субъединицы закрытого натриевого канала NaV1.7, который присутствует в основном в проводящих сигналы боли нейронах спинальных ганглиев (ноцицепторах) и играет чрезвычайно важную роль в этих клетках, увеличивая деполяризацию для усиления сигнала [9, 10]. Однонуклеотидный полиморфизм (single nucleotide polymorphism, SNP) rs6746030 (c.3448 G>A, R1150W) в экзоне 18 SCN9A приводит к замене положительно заряженной аминокислоты аргинин (R) на неполярный триптофан (W). Это смещает потенциалзависимость с 7,9 до 11мВ в деполяризующем направлении и оказывает значительное влияние на функционирование нейронов спинальных ганглиев, деполяризуя их потенциал покоя и удваивая их потенциал действия [9]. Показано, что полиморфизм rs6746030 в значительной степени ассоциирован с восприятием боли при ряде патологических состояний (остеоартрит, ишиас, фантомные боли после ампутации, боли в малом тазу после гинекологических операций). Клинические и экспериментальные исследования подтвердили аддитивную модель эффекта, при которой наиболее сильную боль ощущают носители генотипа AA, а наиболее слабую — носители генотипа GG [10, 13].

В рамках антиноцицептивной системы лучше всего изучен расположенный в локусе шестой хромосомы 6q25.3 ген OPRM1, который кодирует μ-опиоидный рецептор, относящийся к родопсиновому семейству рецепторов, связанных с G-белком [11, 12, 14—16]. Этот рецептор является основной мишенью для неселективных наркотических анальгетиков (морфин, фентанил, промедол), а также может связываться с эндогенными опиоидами (например, β-эндорфинами). Его активация приводит к ингибированию аденилатциклазы, снижению тока через потенциалзависимые кальциевые каналы, открыванию ряда калиевых каналов. Гиперполяризация, вызванная повышением калиевого тока и подавлением входа кальция, способствует уменьшению высвобождения медиатора, что в свою очередь замедляет проведение возбуждения по ноцицептивному тракту [16]. В настоящее время установлено более 100 SNPs в гене OPRM1 [15]. Наиболее часто взаимо-связь с потреблением опиоидных анальгетиков отмечали с полиморфизмом rs1799971 (c. 118A>G, N40D), при котором происходит уменьшение сайтов N-гликозилирования с пяти до четырех на экстрацеллюлярной части рецептора [11, 12, 15]. Показано также, что минорный аллель rs1799971 приводит к снижению сигнальной эффективности µ-опиоидного рецептора в регионе мозга SII, который играет важную роль в формировании интенсивности болевых ощущений [14].

Катехол-О-метилтрансфераза (COMT) является главным деградирующим ферментом в метаболических путях катехоламинергических нейротрансмиттеров, включая дофамин, эпинефрин и норэпинефрин [17, 18]. Для гена COMT, кодирующего этот фермент и расположенного в локусе двадцать второй хромосомы 22q11.2, чаще всего отмечали ассоциации с интенсивностью боли и потребностью в опиоидах [7, 8, 19—22]. Наиболее изученный полиморфизм в этом гене — rs4680 (c.472G>A, p. Val158Met). Этот полиморфизм влияет на термостабильность, и наличие минорного аллеля А приводит к снижению активности COMT в 3—4 раза [18, 22]. Снижение активности, в свою очередь, вероятно, ведет к накоплению эпинефрина и норэпинефрина в периферической и центральной нервной системе, вызывая чрезмерную стимуляцию ноцицептивных β 2/3-адренэргических путей и высокую чувствительность к боли у носителей аллеля 158A [20]. Полиморфизм rs4680 имеет кодоминантный характер наследования с на-именьшей активностью фермента у носителей генотипа AA, наибольшей — у носителей генотипа GG и промежуточным вариантом у носителей генотипа AG [17]. Другой полиморфизм в гене COMT, rs4818 (c. 408C>G, p.Leu136=), представляет собой синонимичную замену, которая, вероятно, влияет на трансляцию фермента через изменения вторичной структуры мРНК [8]. В ряде работ выявлена взаимосвязь большей потребности в опиоидах при острой боли и носительства генотипа GG, в других работах отмечали совместный вклад полиморфизмов rs4818 и rs4680 [7, 12, 19, 23].

Благодаря разработке препаратов VIII и IX факторов свертывания крови появилась возможность проводить эндопротезирование крупных суставов, в том числе тотальное эндопротезирование коленных суставов (ТЭПКС), существенно улучшая качество жизни больных гемофилией [24]. Количество проводимых операций неуклонно растет во всем мире, и они являются зачастую единственным вариантом лечения артрозов не только у пациентов с гемофилией, но и у других категорий больных [25]. Однако, по данным литературы, многие пациенты (без гемофилии), перенесшие ТЭПКС, отмечают лишь небольшое облегчение: 44% пациентов имеют постоянные боли в прооперированной конечности в течение нескольких лет после операции, при этом 15% пациентов страдают от сильной боли [26, 27]. Настоящее исследование направлено на изучение частоты развития послеоперационной острой и хронической боли у пациентов с гемофилией, перенесших ТЭПКС, определение связанных с этим явлением психофизических и генетических факторов риска и оценку их реальной прогностической значимости.

Цель исследования — изучить влияние функциональных генетических полиморфизмов на профиль психофизических показателей у больных гемофилией.

Материал и методы

Проспективное пилотное исследование выполнялось в ФГБУ «НМИЦ гематологии» Минздрава России в период с января 2018 г. по февраль 2019 г. В исследование включен 21 пациент с гемофилией A и B. Всем пациентам выполнено ТЭПКС по поводу тяжелой гемофилической артропатии. Различные показатели оценивались в нескольких временных точках: предоперационные сутки, в день операции, в 1-е, 2-е и 3-и послеоперационные сутки, через 10 дней и спустя 6 мес после операции. Обследование включало следующие обязательные этапы: анкетирование, алгометрию (тестирование на порог боли и болевую толерантность), оценку потребовавшегося количества анальгетиков в интраоперационном и послеоперационном периодах, сбор крови с целью дальнейшего генетического исследования, а также изучение отдаленных результатов. В день перед операцией проводилось анкетирование (более 40 вопросов), определяющее различные характеристики боли и психосоциальной сферы. Интенсивность боли измеряли с помощью числовой (от 0—10 баллов) рейтинговой шкалы (NRS) на 1-е, 2-е, 3-и сутки после операции. Ряд параметров оценивали также через 10 дней после операции. Спустя 6 мес после операции проводили телефонное интервьюирование пациента с целью определения отдаленных результатов, выявления пациентов, страдающих хроническим болевым синдромом.

Критерии включения в исследование:

1. Больные тяжелой формой гемофилии A или B.

2. Возраст: 25—45 лет.

3. Пол — мужской.

4. Эндопротезирование коленного сустава производится впервые.

5. ТЭПКС односторонняя.

6. ТЭПКС в условиях эндотрахеальной анестезии.

7. Расовая принадлежность — европеоидная (во избежание неточностей в генетическом анализе данных).

8. Всем пациентам проводится одинаковая схема анестезии и анальгезии в интраоперационном и послеоперационном периодах.

9. Пациент подписал информированное согласие.

Критерии исключения из исследования:

1. Несоответствие критериям включения.

2. Сопутствующее заболевание, протекающее с болевым синдромом: любой другой диагноз, кроме гемофилической артропатии (сахарный диабет, заболевания соединительной ткани, воспалительные заболевания).

3. Хроническая опиоидная зависимость.

4. Любые психические расстройства, деменция, делирий или любое другое когнитивное расстройство, которое затрудняет сотрудничество с пациентами.

5. Ревизия или любая операция на колене, которая не является первичным, односторонним ТЭПКС.

6. В анамнезе более одного эндопротезирования крупного сустава.

7. В анамнезе более трех оперативных вмешательств.

8. Тяжелые инфекционные осложнения, неконтролируемые проводимой адекватной антибактериальной, противогрибковой и противовирусной терапией.

9. Тяжелая полиорганная недостаточность.

10. Больные, не подписавшие информированное согласие.

Описание операции

Операции проводились бригадой хирургов отделения реконструктивно-восстановительной ортопедии для больных гемофилией ФГБУ «НМИЦ гематологии» Мин-здрава России по одной и той же технологии. Показания к ТЭПКС тщательно устанавливали для каждого пациента, показания к операции включали наличие тяжелой хронической боли и функциональные нарушения в коленном суставе.

Анальгезия и анестезия

Операция проведена в условиях эндотрахеальной анестезии. В интраоперационном и послеоперационном периодах все пациенты получали наркотические и ненаркотические анальгетики. В интраоперационном периоде учитывалось количество введеного опиоидного анальгетика (фентанил). В первые сутки после операции наркотический анальгетик (морфин) вводили посредством контролируемой пациентом анальгезии (КПА), оценивали его количество. Оперативное вмешательство проводили с соблюдением следующих этапов: срединный разрез по передней поверхности коленного сустава; послойное рассечение кожи и подкожно-жировой клетчатки, медиальная артротомия; эндопротезирование с использованием фиксации компонентов на костном цементе. Обязательным этапом являлась установка дренажа в рану в связи с возможными геморрагическими осложнениями.

Оценка интенсивности боли

Сбор данных о боли и ее влиянии на психосоциальную сферу осуществляли с помощью международных опросников (анкет). Использовали 10-балльную шкалу NRS: 0 — нет боли, 10 — самая сильная боль, которую можно представить. Пациенты заполняли характеризующий сенсорную и аффективную составляющие болевого синдрома МакГилловский болевой опросник; анкету Ван Корфа (оценивающую интенсивность болевого синдрома, а также степень и уровень социальной дезадаптации); WOMAC — опросник, характеризующий боль, скованность и функцию коленного сустава; LANSS — анкету по определению нейропатической боли [28—31]. Заполняли также анкеты, в которых дается оценка влияния боли на сон, тревожность, депрессию, усталость, стресс (PSS, Perceived Stress Scale, — шкала воспринимаемого стресса; FSS, Fatigue Severity Scale — шкала оценки уровня усталости; PCS, The Pain Catastrophizing Scale — шкала катастрофизации боли). Проводили тензалгометрию — оценку болевого порога, болевой толерантности путем давления. Механическая сила (надавливание) действовала с помощью алгометра на трапециевидную мышцу в верхней части спины, примерно 5 см латеральнее CVIII остистых отростков с двух сторон. Регистрировалось давление, при котором пациент начинал ощущать не давление, а боль (порог боли), а также давление, при котором боль становилась нестерпимой, либо достижение максимального диапазона давления устройством (20 кг) — толерантность к боли. Этот тест выполняли перед операцией [32, 33].

Методы генетического исследования

Однократный забор крови в пробирку с ЭДТА (этилендиаминтетраацетат) осуществляли с целью проведения генетического исследования функциональных генетических полиморфизмов в трех генах: rs4818 и rs4680 в COMT (catechol-O-methyltransferase), rs1799971 в OPRM1 (mu-opioid receptor) и rs6746030 в SCN9A (α-subunit of the voltage-gated sodium channel Nav1.7).

ДНК выделяли из ядерных клеток периферической крови после селективного лизиса эритроцитов в 0,8% растворе хлорида аммония по стандартной методике, включающей обработку додецилсульфатом натрия (0,5%) и протеиназой К (200 мкг/мл) в течение 16—18 ч при 37 °C или 2 ч при 65 °C с последующей фенольной экстракцией.

Для генотипирования пациентов по функциональным SNPs проводили амплификацию в системе PCR Master Mix (Thermo Scientific, США) с 0,01—0,02 мкг геномной ДНК и 10 пкмоль каждого из праймеров (табл. 1) при следующих условиях: 94 °C — 1 мин, 62 °C — 1 мин, 72 °C — 3 мин, 30 циклов. Олигонуклеотидные праймеры синтезировали в ЗАО «Синтол» (Россия).

Таблица 1. Олигонуклеотидные праймеры, использованные в исследовании

Ген

SNP

Название праймера

5’-3’-последовательность

COMT

rs4818*

COMTdd

CACCTCTCCTCCGTCCCCAA

rs4680

COMTR

CAGGCATGCACACCTTGTCCTTCG

OPRM1

rs1799971

OPRMd

CAACTTGTCCCACTTAGATGt**

OPRMr

CCGAAGAGCCCCACCACGCA

SCN9A

rs6746030

SCNd

GGTTGAGGGAGTATCACAGA

SCNr

GAGCAGGATCATGAGGACAA

Примечание. * — Accession number в базе данных dbSNP; ** — строчной буквой указан нуклеотид, измененный для формирования сайта распознавания рестрикционной эндонуклеазы.

Генотипирование полиморфизма rs1799971 в гене OPRM1 проводили по результатам гидролиза продукта амплификации рестрикционной эндонуклеазой Taq I. С помощью праймера создан сайт распознавания этого фермента. Образующийся в данной системе ПЦР-фрагмент (165 п.н.) после обработки эндонуклеазой Taq I либо оставался интактным (если в полиморфном локусе был нуклеотид А), либо распадался на фрагменты 144 и 21 п.н. (если в полиморфном локусе был нуклеотид G). Генотипирование полиморфизмов rs6746030 в гене SCN9A, rs4818 и rs4680 в гене COMT проводили по результатам секвенирования по методу Сэнгера. ПЦР-фрагменты для секвенирования очищали на колонках Wizard (Promega, США).

Визуализацию продуктов ПЦР и рестрикционного гидролиза проводили с помощью регистрации в ультрафиолетовом свете после разделения электрофорезом в 6% полиакриламидном геле (ПААГ) и прокрашивания бромистым этидием.

Секвенирование проводили в Центре коллективного пользования «Геном» ФГБУН Институт молекулярной биологии им. В.А. Энгельгардта РАН (Москва) с помощью набора реактивов BigDye Terminator v.3.1 (Applied Biosystems, США) с последующим анализом продуктов реакции на автоматическом секвенаторе ABI PRISM 3100Avant (Applied Biosystems, США).

Данные генотипирования сопоставлялись с данными опроса, психофизическими показателями.

Статистические методы

Анализ психофизических показателей проводили в статистическом пакете STATISTICA 8.0 (StatSoft, Inc., США). Все проведенные тесты были двусторонними при уровне значимости α=0,05. Распределение значений всех параметров статистически значимо отклонялось от нормального (тест Колмогорова—Смирнова (Kolmogorov—Smirnov test) и тест Шапиро—Уилка (Shapiro—Wilk’s W test), p>0,05). В связи с этим значения описательной статистики приведены в виде медианы и минимального и максимального значений. Для сравнения групп пациентов с различными генотипами применяли U-критерий Манна—Уитни или тест Краскала—Уоллиса (Kruskal—Wallis ANOVA). Это исследование является пилотным, поэтому поправок уровня значимости для множественных попарных сравнений мы не вводили.

В программной среде R (34 R Core Team (2019) R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. URL https://www.R-project.org/) [34] с использованием пакета «genetics» проводили тест на отклонение от состояния равновесия Харди—Вайнберга (exact test for deviation from Hardy—Weinberg equilibrium) для всех исследуемых полиморфизмов, а для SNPs в гене COMT еще и тест на сцепленность локусов (linkage disequilibrium (LD) D’ test), так как они расположены близко друг к другу. Для всех исследуемых полиморфизмов показаны кодоминантное наследование и аддитивная модель влияния генотипа на фенотип [10—13, 15, 17], поэтому мы не рассматривали доминантную и рецессивную модели.

Результаты

Описательная статистика полиморфизмов в генах COMT, OPRM1 и SCN9A приведена в табл. 2. Анализ распределения частот генотипов у больных гемофилией показал, что в полиморфном локусе rs4818 гена COMT с на-иболее высокой частотой (57,1%) встречался гомозиготный генотип СС, гетерозиготный генотип CG определялся в 28,6% случаев, гомозиготный генотип GG встретился в 14,3% случаев. В другом изученном полиморфном локусе rs4680 гена COMT с наиболее высокой частотой (42,8%) определялся гетерозиготный генотип AG, а гомозиготные генотипы AA и GG встречались с одинаковой частотой в 28,6% (см. табл. 2). В полиморфном локусе rs6746030 гена SCN9A с наиболее высокой частотой (83,3%) встречался гомозиготный генотип GG, гетерозиготный генотип AG определялся в 16,7% случаев, гомозиготный генотип AA не выявлен. В полиморфном локусе rs1799971 гена OPRM1 с наиболее высокой частотой (76,2%) встречался гомозиготный генотип АА, гетерозиготный генотип AG определялся в 23,8% случаев, гомозиготный генотип GG не выявлен (см. табл. 2). Ни один из полиморфизмов не отклонялся статистически значимо от состояния равновесия Харди—Вайнберга. Тест на сцепленность локусов (LD) показал значительное сцепление между rs4818 и rs4680 (99,9%), однако это может быть также связано со значительным преобладанием в исследуемой выборке мажорных гомозиготных генотипов.

Таблица 2. Описательная статистика полиморфизмов в генах COMT, OPRM1 и SCN9A

Ген

SNP

Хромосома

Генотип

n (%)

Минорный аллель, частота

HWE*, p

COMT

rs4818

22

CC

12 (57,1)

G, 0,34

0,29

CG

6 (28,6)

GG

3 (14,3)

COMT

rs4680

22

GG

6 (28,6)

A, 0,46

0,65

AG

9 (42,8)

AA

6 (28,6)

OPRM1

rs1799971

6

AA

16 (76,2)

G, 0,19

1

AG

5 (23,8)

GG

0

SCN9A

rs6746030

2

GG

18 (85,7)

A, 0,12

1

AG

3 (14,3)

AA

0

Примечание. * — результаты теста на отклонение от равновесия Харди—Вайнберга и значение p.

Статистически значимых различий между фенотипическими характеристиками больных гемофилией с различными аллелями полиморфных локусов в гене COMT не выявлено (p>0,05).

У пациентов с гетерозиготным носительством в гене SCN9A (AG) при одинаковом расходе анальгетиков в интраоперационном и послеоперационном периодах наблюдались статистически значимо меньшие показатели боли по шкале NRS в первые трое суток после операции (p<0,05). В частности, больные с гомозиготным носительством (GG) боль оценивали в среднем в диапазоне от 3 до 7 баллов, что соответствует боли высокой и средней интенсивности. У пациентов с гетерозиготным носительством (AG) наблюдались очень низкие показатели боли — от 1 до 5 баллов (низкая интенсивность боли) по 10-балльной шкале NRS (табл. 3).

Таблица 3. Фенотипические характеристики больных гемофилией с различными генотипами полиморфизмов в генах COMT, OPRM1 и SCN9A

Показатель

OPRM1 AA (n=16)

OPRM1 AG (n=5)

SCN9A GG (n=18)

SCN9A AG (n=3)

COMT rs4818 CC (n=12)

COMT rs4818 CG (n=6)

COMT rs4818 GG (n=3)

COMT rs4680 GG (n=6)

COMT rs4680 AG (n=9)

COMT rs4680 AA (n=6)

Длительность операции, мин

130 (90—205)

150 (120—170)

135 (95—185)

107 (90—205)

135 (90—185)

117,5 (95—205)

140 (130—150)

145 (100—205)

120 (95—160)

142,5 (90—170)

Расход опиоидов во время операции (фентанил), мг

0,6 (0,4—0,8)

0,7 (0,5—0,9)

0,6 (0,4—0,9)

0,5 (0,5—0,8)

0,65 (0,5—0,9)

0,5 (0,5—0,7)

0,7 (0,4—0,7)

0,6 (0,4—0,8)

0,6 (0,5—0,7)

0,7 (0,5—0,9)

Расход опиоидов после операции (морфин), мг

20 (6,6—40)

20 (6,6—20)

20 (6,6—40)

20 (20—23,3)

20 (6,6—23,3)

21,65 (6,6—40)

20 (6,6—23,3)

21,65 (6,6—40)

20 (6,6—23,3)

20 (6,6—23,3)

Кровопотеря, мл

375 (175—1150)

650 (150—1150)

400 (150—1150)

200 (175—350)

400 (175—1150)

350 (150—650)

400 (200—600)

375 (200—1150)

400 (150—650)

425 (175—1150)

По дренажу кровопотеря за первые сутки после операции, мл

455 (200—900)

300 (150—650)

425 (150—900)

460 (250—650)

430 (200—900)

350 (150—650)

510 (280—770)

365 (200—770)

550 (150—900)

430 (260—650)

Гемоглобин, г/л

154,5 (121—200)

150 (134—180)

154,5 (121—200)

135 (134—157)

158 (134—200)

145 (134—165)

129 (121—149)

142 (121—167)

154 (134—200)

158 (134—180)

Лейкоциты, тыс/мкл

7,15 (4,8—35)

6,7 (4—9)

6,8 (4—35)

16 (4,8—19)

7,545 (4—35)

6,45 (4,8—9,5)

7,4 (6,4—8,4)

7,795 (4,8—9,5)

6,7 (4,8—35)

7,15 (4—19)

Тромбоциты, тыс/мкл

292 (169—877)

159 (148—447)

265,5 (148—877)

232 (207—291)

216 (148—409)

323 (159—877)

300 (220—322)

311 (220—877)

293 (159—447)

207,5 (148—232)

Глюкоза, ммоль/л

5,55 (5—9,4)

6 (5—6,3)

5,55 (5—9,4)

5,7 (5,4—6,4)

5,55 (5—9,4)

5,85 (5—6,3)

5,2 (5—6,1)

5,65 (5—6,2)

5,5 (5—9,4)

6,05 (5—6,4)

Лактат, ммоль/л

1,5 (0,9—2,8)

1,8 (1,4—2,1)

1,65 (0,9—2,8)

1,2 (1,2—1,5)

1,7 (1,2—2,8)

1,6 (1,2—1,7)

1,1 (0,9—1,4)

1,3 (0,9—2,3)

1,6 (1,4—2,6)

1,8 (1,2—2,8)

РН

7,37 (7,3—7,5)

7,4 (7,3—7,4)

7,37 (7,3—7,5)

7,4 (7,4—7,4)

7,4 (7,3—7,4)

7,385 (7,3—7,4)

7,3 (7,3—7,5)

7,335 (7,3—7,5)

7,37 (7,3—7,4)

7,4 (7,3—7,4)

Шкала NRS, 1-е сутки после операции, баллы

6,5 (2—10)

4 (3—5)

5 (3—10)*

5 (2—5) *

5 (2—9)

5 (3—10)

5 (n=1)**

7 (5—10)

5 (7,3—7,4)

5 (2—8)

6 (1—10)

4,5 (3—6)

6 (3—10)*

2 (1—4)*

5 (2—9)

6 (1—10)

5 (n=1)

7 (1—9)

6 (3—10)

4 (2—8)

7 (2—10)

4,5 (3—7)

7 (3—10)*

3 (2—4)*

6 (2—10)

5 (3—10)

6 (n=1)

7,5 (3—9)

5 (4—10)

4 (2—10)

Шкала NRS, 2-е сутки после операции, баллы

5,5 (2—10)

5,5 (4—7)

6 (4—10)*

3 (2—4)*

5 (3—9)

7 (2—10)

7 (n=1)

8 (2—9)

5 (3—10)

5 (3—6)

5 (2—7)

6 (5—7)

6 (3—7)*

2 (2—3)*

5,5 (2—7)

7 (2—7)

5 (n=1)

5 (2—7)

6,5 (4—10)

5 (2—6)

5 (0—8)

5 (4—6)

5 (0—8)*

2 (2—3)*

4,5 (0—8)

5 (2—6)

7 (n=1)

6 (2—7)

5 (3—7)

4 (2—6)

4 (2—8)

6 (5—7)

6 (3—8)*

2 (2—2)*

5,5 (2—8)

5 (2—7)

4 (n=1)

4 (2—6)

5 (0—8)

6 (2—8)

Шкала NRS, 3-и сутки после операции, баллы

5 (1—10)

6 (6—6)

6 (2—10)*

1 (1—2)*

5,5 (1—10)

6 (1—6)

5 (n=1)

5 (1—5)

6 (3—7)

6 (1—6)

5 (1—8)

4 (4—6)

5 (3—8)*

1 (1—2)*

4,5 (1—8)

5 (1—6)

6 (n=1)

6 (1—6)

5 (2—10)

4 (1—6)

5 (1—8)

4 (4—4)

5 (3—8)*

1 (1—2)*

4 (1—8)

4 (1—5)

5 (n=1)

5 (1—5)

4,5 (3—8)

4 (1—6)

3 (0—8)

3 (3—4)

3 (0—8)*

2 (1—2)*

3 (0—8)

3 (1—4)

5 (n=1)

5 (1—6)

3 (3—8)

3 (2—8)

Шкала LANSS, баллы

11 (0—21)

16 (1—17)

11 (1—19)

14 (0—21)

12 (1—21)

10 (0—17)

6 (n=1)

6 (0—13)

10,5 (0—4)

16 (1—21)

Шкала МакГилла, баллы

Сенсорная ИЧВД

5 (1—13)

13 (8—14)

8 (1—14)

5 (1—13)

6 (1—13)

13 (1—14)

10 (n=1)

13 (10—13)

4,5 (5—17)

5 (1—13)

Сенсорная РИБ

6 (1—31)*

28 (21—36)*

19 (1—36)

6 (3—31)

10 (1—28)

31 (1—36)

19 (n=1)

19 (19—31)

9 (1—14)

6 (2—28)

Аффективная ИЧВД

5 (1—6)

5 (5—6)

5 (1—6)

5 (5—5)

5 (1—6)

5 (1—5)

4 (n=1)

5 (4—6)

3,5 (1—36)

5 (1—6)

Аффективная РИБ

7 (1—13)

9 (8—9)

7 (1—11)

12 (6—13)

8 (1—13)

8 (3—12)

7 (n=1)

10 (7—12)

5 (1—5)

9 (1—13)

ИЧВД суммарный балл

10 (2—19)

19 (13—19)

13 (2—19)

10 (6—18)

11 (2—19)

18 (2—19)

14 (n=1)

18 (14—19)

7,5 (1—11)

10 (2—19)

РИБ суммарный балл

16 (3—43)*

37 (30—44)*

26 (3—44)

16 (12—43)

20,5 (3—37)

43 (4—44)

26 (n=1)

29 (26—43)

15 (2—19)

16 (3—37)

Шкала Ван Корфа

Интенсивность боли, баллы

12 (4—21)

15 (10—19)

14,5 (5—21)

6,5 (4—9)

13 (5—21)

11 (4—15)

16 (n=1)

10 (4—16)

14,5 (4—44)

11 (9—19)

Социальная дезадаптация, баллы

7 (0—20)

14 (9—20)

9,5 (0—20)

4 (4—4)

8,5 (4—20)

4 (0—14)

20 (n=1)

12 (4—20)

7,5 (5—21)

9,5 (4—20)

Дни нетрудоспособности, дни

10 (3—100)

7 (7—180)

7 (3—180)

12,5 (10—15)

8,5 (3—180)

7 (5—10)

100 (n=1)

55 (10—100)

6 (0—17)

12,5 (7—180)

Шкала WOMAC, баллы

Интенсивность боли

5 (3—9)

8 (7—11)

7,5 (3—11)

5,5 (4—7)

6 (3—8)

9 (4—11)

9 (n=1)

6,5 (4—9)

5 (3—50)

7,5 (7—8)

Скованность

4 (3—6)

5 (4—6)

4 (3—6)

3,5 (3—4)

4 (3—6)

4 (4—5)

3 (n=1)

3,5 (3—4)

4 (3—11)

4,5 (3—6)

Функция коленного сустава

14 (5—21)

28 (16—46)

17,5 (5—46)

13 (9—17)

18 (9—46)

9 (5—28)

14 (n=1)

11,5 (9—14)

16,5 (3—6)

18 (16—46)

Физическое функционирование

52,5 (25—75)*

25 (5—35)*

50 (5—75)

25 (n=1)

50 (5—75)

25 (25—65)

55 (n=1)

40 (25—55)

57,5 (5—28)

35 (5—50)

Ролевое функционирование, обусловленное физическим состоянием

62,5 (0—100)

25 (0—75)

37,5 (0—100)

75 (n=1)

50 (0—100)

75 (25—100)

0 (n=1)

37,5 (0—75)

62,5 (25—75)

0 (0—75)

Интенсивность боли

52 (22—90)

32 (20—45)

45 (20—90)

77 (n=1)

45 (20—90)

57 (32—77)

22 (n=1)

49,5 (22—77)

52 (0—100)

45 (20—45)

Общее состояние здоровья

65 (25—80)

45 (35—80)

65 (35—80)

25 (n=1)

55 (45—80)

35 (25—80)

75 (n=1)

50 (25—75)

65 (32—90)

55 (45—80)

Жизненная активность

70 (55—80)*

50 (20—50)*

62,5 (20—80)

65 (n=1)

60 (20—80)

65 (50—75)

80 (n=1)

72,5 (65—80)

70 (35—80)

50 (20—55)

Социальное функционирование

81 (50—100)

62 (37—75)

75 (37—100)

62 (n=1)

75 (50—87)

62 (37—100)

50 (n=1)

56 (50—62)

87 (50—80)

62 (50—75)

Ролевое функционирование, обусловленное эмоциональным состоянием

100 (0—100)

33 (33—66)

66 (0—100)

100 (n=1)

66 (0—100)

66 (33—100)

100 (n=1)

100 (100—100)

83 (37—100)

33 (0—66)

Психическое здоровье

74 (60—84)*

44 (36—64)*

68 (36—84)

64 (n=1)

64 (36—84)

64 (44—76)

72 (n=1)

68 (64—72)

78 (33—100)

64 (36—64)

Шкала HADS, баллы

Тревога

5 (2—10)

9 (4—11)

6 (2—11)

6,5 (4—9)

7 (2—11)

4 (4—9)

3 (n=1)

4 (3—9)

5 (44—84)

8 (4—11)

Депрессия

3 (1—13)

6 (0—8)

3 (0—8)

6 (2—13)

4,5 (0—13)

2 (1—8)

2 (n=1)

2 (2—7)

3 (2—10)

6 (0—13)

Шкала PSS, баллы

Перенапряжение

13 (10—19)*

18 (16—21)*

16 (10—21)

13 (12—13)

16 (11—21)

12 (10—18)

11 (n=1)

11,5 (11—12)

14,5 (1—8)

16 (13—21)

Противодействие стрессу

6 (4—9)*

10 (9—10)*

8 (4—10)

4,5 (4—5)

7,5 (4—10)

5 (4—10)

9 (n=1)

7 (5—9)

6,5 (10—19)

8,5 (4—10)

Шкала воспринимаемого стресса

19 (14—27)*

28 (25—31)*

23,5 (14—31)

16,5 (16—17)

23,5 (17—31)

16 (14—28)

20 (n=1)

18 (16—20)

21 (4—10)

24,5 (17—31)

Шкала FSS, баллы

32 (15—63)*

21 (18—47)*

30 (15—48)

33 (31—63)

33 (21—63)

18 (15—31)

27 (n=1)

29 (27—31)

30 (14—28)

47 (21—63)

Катастрофизация, баллы

Безнадежность

4 (0—18)

4 (0—4)

4 (0—10)

11,5 (5—18)

4 (0—10)

4 (4—18)

0 (n=1)

9 (0—18)

4 (15—48)

4,5 (0—10)

Преувеличение

4 (0—9)

5 (1—6)

4,5 (0—9)

5 (2—8)

5 (0—9)

5 (1—8)

0 (n=1)

4 (0—8)

4,5 (1—6)

4 (1—7)

Постоянное размышление

3 (0—12)

4 (0—7)

3 (0—12)

4,5 (3—6)

3,5 (0—12)

6 (2—7)

0 (n=1)

3 (0—6)

4 (0—9)

3,5 (0—12)

Качество сна

15 (12—21)

18 (14—18)

15 (12—19)

15 (12—21)

14,5 (12—21)

16 (15—18)

12 (n=1)

15 (12—19)

14,5 (6—19)

15 (12—21)

Алгометрия

Болевой порог

3 (1,8—4,5)

3,3 (2,4—3,9)

3 (1,8—3,9)

3,3 (2,7—4,5)

2,85 (1,8—3,9)

3,5 (3,3—4,5)

2,1 (n=1)

3,2 (2,1—4,5)

3,15 (12—19)

2,7 (2,4—3,9)

Болевая толерантность

3,8 (2,5—6,8)

3,7 (3,2—4,6)

3,8 (2,5—5,8)

3,5 (3,5—6,8)

3,65 (2,5—5,8)

4,5 (3,7—6,8)

2,5 (n=1)

4,2 (2,5—6,8)

3,9 (1,8—3,5)

3,5 (3,1—4,6)

Шкала LANSS через 10 суток после операции, баллы

7,5 (5—17)

14 (2—16)

10 (2—17)

6 (n=1)

6 (2—14)

16 (6—17)

9 (n=1)

7,5 (6—9)

9 (5—17)

11 (2—14)

Шкала МакГилла, через 10 суток после операции, баллы

Сенсорная ИЧВД

2,5 (1—13)*

10 (8—13)*

3,5 (1—13)

13 (n=1)

4 (1—13)

10 (1—13)

1 (n=1)

7 (1—13)

3,5 (5—17)

8 (2—13)

Сенсорная РИБ

3 (2—30)

21 (11—28)

3,5 (2—28)

30 (n=1)

3 (2—28)

11 (2—30)

4 (n=1)

17 (4—30)

3 (1—10)

21 (2—28)

Аффективная ИЧВД

1,5 (1—6)

5 (2—6)

2 (1—6)

6 (n=1)

2 (1—6)

2 (1—6)

2 (n=1)

4 (2—6)

1,5 (2—11)

5 (1—6)

Аффективная РИБ

3 (1—11)

9 (2—9)

3 (1—9)

11 (n=1)

3 (1—9)

3 (2—11)

2 (n=1)

6,5 (2—11)

3 (1—3)

9 (1—9)

ИЧВД, суммарный балл

2,5 (2—19)*

13 (12—19)*

3 (2—19)

19 (n=1)

3 (2—19)

12 (2—19)

2 (n=1)

10,5 (2—19)

2,5 (2—3)

13 (3—19)

РИБ, суммарный балл

5 (3—41)

30 (13—37)

5,5 (3—37)

41 (n=1)

5 (3—37)

13 (5—41)

6 (n=1)

23,5 (6—41)

5 (2—12)

30 (3—37)

Шкала HADS, через 10 суток после операции, баллы

Тревога

9 (2—12)

4 (2—11)

9 (2—12)

4 (n=1)

10 (2—12)

4 (2—9)

2 (n=1)

4 (2—9)

8,5 (3—14)

11 (4—12)

Депрессия

7 (1—10)

4 (0—6)

6 (0—10)

2 (n=1)

7 (0—10)

4 (2—4)

2 (n=1)

2 (2—7)

5,5 (2—12)

6 (0—10)

Качество сна

19 (15—21)*

14 (14—17)*

18 (14—21)

20 (n=1)

19 (14—21)

18 (17—20)

15 (n=1)

19 (15—20)

18,5 (1—9)

14 (14—19)

Примечание. * — p<0,05, тест Манна—Уитни; ** — данные получены только для одного больного, поэтому применение статистических тестов невозможно. ИЧВД — индекс числа выделенных дескрипторов; РИБ — ранговый индекс боли.

У больных гемофилией с генотипами АА и AG в гене OPRM1 отмечен примерно одинаковый расход наркотических анальгетиков в интраоперационном и послеоперационном периодах при схожих показателях оценки боли по 10-балльной шкале NRS (p>0,05; см. табл. 3). Однако обращает на себя внимание то, что больные гемофилией с генотипом AG в гене OPRM1 испытывали более интенсивную боль по шкале МакГилла, а уровень перенапряжения и стресса по шкале PSS у них был выше по сравнению с носителями гомозиготного генотипа AA (p<0,05). Кроме того, они имели статистически значимо более низкие баллы по шкале SF36, включающей такие показатели, как физическое и психическое здоровье, жизненная активность, и по шкале FSS, характеризующей уровень усталости (p<0,05). Через 10 дней после операции больные с генотипом AG продолжали оценивать боль как более интенсивную по ряду параметров шкалы МакГилла, а также имели более низкое качество сна (p<0,05).

Не отмечалось статистически значимых различий между потреблением наркотических анальгетиков больными с различными генотипами при примерно одинаковой продолжительности операции и объеме кровопотери, однако при сходном расходе анальгетиков в интраоперационном и послеоперационном периодах пациенты демонстрировали разные показатели по шкалам боли.

Хроническая послеоперационная боль (ХПБ) зарегистрирована у 3 из 21 пациента с гемофилией, перенесших ТЭПКС. Обращало на себя внимание, что при примерно одинаковом интраоперационном и послеоперационном расходе опиоидов (фентанил 0,6 мг и морфин 20 мг) боль в первые трое суток была интенсивнее у пациентов с ХПБ (табл. 4). Так, у пациентов с формированием ХПБ интенсивность боли в 1-е послеоперационные сутки была максимальной — 10 баллов по NRS, в группе у пациентов, которых не беспокоила ХПБ после ТЭПКС, интенсивность боли в 1-е послеоперационные сутки варьировала от 4 до 8 баллов по NRS. На 3-и послеоперационные сутки боль у всех пациентов имела одинаковую среднюю интенсивность. При этом пациенты с ХПБ в большей степени демонстрировали в предоперационном периоде выраженность болевого синдрома по шкале МакГилл. Пороги боли и толерантность к боли были примерно одинаковыми у пациентов обеих групп. По шкале LANSS было примерно одинаковое количество баллов в предоперационном периоде. Однако через 10 дней после операции при повторной оценке обнаружен несколько повышенный показатель. Так, у пациентов без ХПБ количество баллов до операции составляло 11 (5—15), через 10 дней после операции — 6 (5—12) по шкале нейропатической боли, а у пациентов с ХПБ этот показатель остался на исходном уровне и в среднем составил 14 баллов (указывает на наличие нейропатической боли). По остальным параметрам группы не различались (см. табл. 4). Не отмечены различия между группами в показателях по шкале Ван Корфа, куда входит определение дней нетрудоспособности, социальной дезадаптации, а также по шкале WOMAC, где примерно одинаково все пациенты оценивали скованность, нарушение функции коленного сустава. Не отмечалось статистически значимых различий между группами по шкале HADS (тревога и депрессия) — регистрировалось нормальное и пограничное психологическое состояние. Выявлена тенденция к нарастанию тревоги и депрессии в послеоперационном периоде в отсутствие разницы в PSS (Шкала воспринимаемого стресса). По шкале FSS (уровень усталости) общий балл менее 36 предполагает, что пациент не страдает от усталости. При оценке качества сна при поступлении регистрировался общий одинаковый балл 14, через 10 дней после поступления отмечается некоторое ухудшение (18 баллов), но в пределах нормальных значений (до 19 баллов — норма).

Таблица 4. Фенотипические и генотипические характеристики пациентов с гемофилией, перенесших тотальное эндопротезирование коленных суставов

Показатель

Пациенты без ХПБ (n=18)

Пациенты с ХПБ (n=3)

Возраст, ет

37,5 (25—48)

37 (30—43)

Генотипы rs1799971, OPRM1

AA, AG

AA

Генотипы rs6746030, SCN9A

GG, GA

GG

Генотипы rs4818, COMT

CC, CG, GG

CC, CG, GG

Генотипы rs4680, COMT

AA, AG, GG

AA, AG, GG

Длительность операции, мин

130 (90—205)

140 (115—145)

Расход опиоидов после операции (морфин), мг

20 (6,6—40)

20 (20—23,3)

Кровопотеря, мл

375 (150—1150)

400 (300—500)

По дренажу кровопотеря за первые сутки после операции, мл

425 (150—900)

510 (400—550)

Гемоглобин, г/л

152 (121—200)

155 (149—159)

Лейкоциты (тыс./мкл)

7,15 (4—35)

6,1 (5,9—8,4)

Тромбоциты, тыс./мкл

261,5 (148—877)

238 (224—300)

РН

7,39 (7,3—7,4)

7,4 (7,34—7,5)

Глюкоза, ммоль/л

5,65 (5—9,4)

5,5 (5,2—6,1)

Лактат, ммоль/л

1,55 (0,9—2,6)

1,7 (1,1—2,8)

Шкала NRS, 1-е сутки после операции, баллы

5 (2—10)

9 (8—10)

5 (1—9)

9 (8—10)

5 (2—9)*

10 (10—10)*

Шкала NRS, 2-е сутки после операции, баллы

5 (2—9)

8 (6—10)

5 (2—7)

6,5 (6—7)

4,5 (0—8)

5,5 (5—6)

4,5 (2—7)*

7,5 (7—8)*

Шкала NRS, 3-и сутки после операции, баллы

5 (1—10)

6 (6—6)

4,5 (1—8)

5,5 (5—6)

4 (1—8)

5,5 (5—6)

3 (0—6)

5,5 (3—8)

Шкала МакГилла, баллы

Сенсорная ИЧВД

9 (1—14)

1 (1—1)

Сенсорная РИБ

19 (1—36)

1,5 (1—2)

Аффективная ИЧВД

5 (1—6)*

1 (1—1)*

Аффективная РИБ

8,5 (1—13)

2 (1—3)

ИЧВД суммарный балл

13,5 (3—19)*

2 (2—2)*

РИБ суммарный балл

27,5 (4—44)*

3,5 (3—4)*

LANSS, баллы

11 (0—21)

14,5 (10—19)

Шкала Ван Корфа, баллы

Интенсивность боли, баллы

14,5 (4—21)

11,5 (11—12)

Дни нетрудоспособности, дни

8,5 (3—180)

7,5 (5—10)

Социальная дезадаптация, баллы

8,5 (4—20)

5 (0—10)

Шкала WOMAC, баллы

Интенсивность боли

6 (3—11)

8,5 (8—9)

Скованность

4 (3—6)

4,5 (4—5)

Функция коленного сустава

16,5 (9—46)

12 (5—19)

Физическое функционирование

45 (5—75)

57,5 (50—65)

Ролевое функционирование, обусловленное физическим состоянием

50 (0—100)

50 (0—100)

Интенсивность боли

45 (20—90)

51 (45—57)

Общее состояние здоровья

55 (25—80)

67,5 (55—80)

Жизненная активность

65 (20—80)

65 (55—75)

Социальное функционирование

75 (37—87)

75 (50—100)

Ролевое функционирование, обусловленное эмоциональным состоянием

100 (33—100)

33 (0—66)

Психическое здоровье

64 (36—84)

70 (64—76)

Шкала HADS, баллы

Тревога

6 (2—11)

5,5 (4—7)

Депрессия

4,5 (0—13)

1,5 (1—2)

Шкала PSS, баллы

Перенапряжение

13 (11—21)

13 (10—16)

Противодействие стрессу

7,5 (4—10)

6 (4—8)

Шкала воспринимаемого стресса

21,5 (16—31)

19 (14—24)

Шкала FSS

31 (18—63)

31 (15—47)

Катастрофизация, баллы

Постоянное размышление

3,5 (0—7)

7 (2—12)

Преувеличение

4,5 (0—9)

4 (1—7)

Безнадежность

4 (0—18)

7 (4—10)

Качество сна

14,5 (12—21)

15,5 (15—16)

Алгометрия

Болевой порог

3,1 (1,8—4,5)

3 (2,5—3,5)

Болевая толерантность

3,75 (2,5—6,8)

3,8 (3,1—4,5)

Шкала LANSS через 10 суток после операции

6 (2—16)

14 (11—17)

Шкала МакГилл через 10 суток после операции, баллы

Сенсорная ИЧВД

4 (1—13)

1,5 (1—2)

Сенсорная РИБ

11 (2—30)

2 (2—2)

Аффективная ИЧВД

2 (1—6)

1 (1—1)

Аффективная РИБ

3 (2—11)

2 (1—3)

ИЧВД суммарный балл

6 (2—19)

2,5 (2—3)

РИБ суммарный балл

13 (3—41)

4 (3—5)

Шкала HADS через 10 суток после операции, баллы

Тревога

6 (2—12)

10,5 (9—12)

Депрессия

5 (0—9)

7 (4—10)

Качество сна через 10 суток после операции

18,5 (14—21)

18,5 (18—19)

Примечание. * — p<0,05, тест Манна—Уитни. ХПБ — хроническая послеоперационная боль; ИЧВД — индекс числа выделенных дескрипторов; РИБ — ранговый индекс боли.

Обсуждение

Данные литературы подтверждают, что настоящее исследование является первым в отношении изучения фенотипических профилей больных гемофилией с различными генотипами полиморфизмов в генах COMT, OPRM1 и SCN9A.

Основная предпосылка состояла в том, что гены могут вносить свой вклад в связанные с болью психосоциальные (например, настроение, сон и копирующее поведение) и психофизические (различные характеристики ощущения боли, болевой порог и толерантность к боли) характеристики, поэтому совокупность этих характеристик можно рассматривать в качестве средних болевых фенотипов в генетических исследованиях по боли.

Основная гипотеза настоящего исследования заключалась в том, что гены и психосоциальные факторы могут влиять на результаты операции независимо друг от друга, во взаимодействии и/или взаимодействуя с факторами окружающей среды (например, демографическими и клиническими). Для подтверждения этой гипотезы мы проводили генотипирование пациентов по ряду генов, которые, по данным литературы, могут быть ассоциированы с болью, а также сбор клинических данных, данных по боли (вопросники по боли и алгометрия — тест на чувствительность) и психосоциальных данных каждого пациента.

Гемофилическая артропатия — состояние, сопровождающееся хроническим болевым синдромом и значительно затрудняющее физическую активность, снижающее качество жизни. Для большинства больных гемофилией единственным методом лечения остается ТЭПКС. Последние исследования показывают, что только 70% пациентов, перенесших ТЭПКС по поводу остеоартитов коленного сустава (пациенты без гемофилии), удовлетворены результатами операции (отмечают нормализацию функции сустава и уменьшение боли). Остальные 30% пациентов по-прежнему ощущают боль, ограничивающую функцию сустава. В доступной нам литературе подобных данных относительно больных гемофилией не найдено. Как показало настоящее исследование, хроническая боль после ТЭПКС зарегистрирована у 3 (14%) из 21 пациента.

Известно, что у разных людей хирургические вмешательства могут вызывать боль неодинаковой интенсивности, и пациентам может потребоваться разное количество обезболивающих средств [4, 5, 25]. Степень болевой чувствительности и потребность в анальгетиках могут зависеть от социодемографических и генетических особенностей пациента, его психоэмоционального статуса, продолжительности и особенностей исходного болевого синдрома, опыта предшествующих операций. В повседневной практике мы часто оказываемся не в состоянии обеспечить пациентам адекватное послеоперационное обезболивание по требованию в связи с неспособностью организовать почасовой мониторинг и документацию интенсивности боли, нехваткой кадров и недостаточной подготовкой персонала. При использовании превентивного мультимодального подхода результаты обезболивания значительно улучшаются, однако становится возможной ситуация, при которой пациент с низкой интенсивностью боли в плановом порядке получит анальгетики в стандартной назначенной суточной дозе и подвергнет себя опасности испытать их побочные эффекты. Такие неблагоприятные явления могут значительно снижать качество жизни больных и их удовлетворенность послеоперационным обезболиванием, затруднять раннюю мобилизацию и увеличивать продолжительность и стоимость лечения.

В свете изложенного выше представляется перспективной задача прогнозирования интенсивности послеоперационной боли и потребности в анальгетиках с учетом индивидуальной болевой чувствительности пациента. Вероятно, это могло бы в дальнейшем помочь с отбором больных для оперативного лечения, а также с созданием дифференцированных протоколов интраоперационного и послеоперационного обезболивания, лечения и реабилитации. Например, при высокой чувствительности к боли у пациента можно остановиться на консервативном пути лечения, а в случае неизбежности операции использовать более совершенные технологии обезболивания, в то время как у больного с низкой чувствительностью к боли применять менее агрессивные и простые методы послеоперационной анальгезии.

Исследования послеоперационной боли показывают, что определенные факторы риска коррелируют с болью. Последние исследования показали важность психосоциальных, психофизических и клинических факторов, влияющих на развитие хронического послеоперационного болевого синдрома (хроническая боль до операции, депрессия, высокий индекс массы тела, молодой возраст, женский пол, рентгенологические признаки тяжести остеоартрита) [28], однако объясняющих не все случаи «неадекватного» болевого синдрома.

В многочисленных исследованиях показано, что на степень проявления болевых ощущений оказывает влияние ряд генов, контролирующих функции компонентов ноцицептивной сенсорной системы [6, 8, 10, 12, 14, 18, 20, 28]. Предположительно вклад генетических факторов в формирование болевой чувствительности составляет 25—50% [35, 36]. Показано, что некоторые генетические варианты изменяют возникновение, передачу и обработку ноцицептивной информации или местную доступность активных анальгетиков и их фармакодинамический эффект. Каждый отдельно взятый генетический вариант оказывает умеренное действие на восприятие боли, однако в совокупности они формируют разнообразие степени болевой чувствительности в мировой популяции [6]. Ассоциации с ХПБ и с различиями в потребности в опиоидах чаще всего отмечают для генов COMT, OPRM1 и SCN9A [7—12].

Для кодирующего главный деградирующий фермент в метаболических путях катехоламинергических нейротрансмиттеров гена COMT чаще всего отмечали ассоциации между носительством минорных аллелей, интенсивностью боли и потребностью в опиоидах [7—12]. Наиболее известные полиморфизмы в этом гене rs4680 и rs4818, причем в ряде работ отмечали их совместный вклад [7, 17, 19, 23]. Однако в данном исследовании статистически значимого влияния аллелей c. 1947G>A (rs4680) и c. 408C>G (rs4818) на испытываемую боль и потребность в анальгетиках не выявлено. Тем не менее далеко не во всех работах ранее обнаруживали четкую взаимосвязь с этими полиморфизмами [19, 20, 23], возможно, ген COMT участвует в развитии не всех типов боли.

М-опиоидный рецептор (OPRM1) является основной мишенью для эндогенных и экзогенных опиоидов, поэтому функциональные полиморфизмы в кодирующем его гене могут обусловливать различную частоту, интенсивность или продолжительность хронической боли и реакцию на опиоиды [15, 16]. В частности, неоднократно показано влияние на эти параметры, особенно на увеличение интенсивности боли и потребности в опиоидах, минорного аллеля G SNP rs1799971 [37]. В настоящем исследовании у больных гемофилией статистически значимого влияния минорного аллеля G в гене OPRM1 на расход наркотических анальгетиков в интраоперационном и послеоперационном периодах и на показатели оценки боли по шкале NRS не выявлено. Обращает на себя внимание, что носители этого аллеля имели тенденцию к более интенсивным болевым ощущениям по шкале МакГилла: у них был выше уровень перенапряжения, восприятия и противодействия стрессу и ниже уровень физического и психического здоровья, жизненной активности, возможности справляться со стрессом и качества сна.

Ген SCN9A, кодирующий альфа-субъединицы закрытого натриевого канала NaV1.7, отвечает за нарушения в восприятии боли у человека: редкие нонсенс-мутации вызывают неспособность на протяжении всей жизни чувствовать боль (полная анальгезия), в то время как редкие активирующие мутации вызывают сильную боль. Таким образом, мутации в гене SCN9A связывают с синдромами как сниженного, так и повышенного восприятия боли [10]. В настоящем исследовании у пациентов с гетерозиготным генотипом в гене SCN9A (AG, rs6746030) наблюдались значительно меньшие показатели боли по шкале NRS в первые трое суток после операции при одинаковом расходе анальгетиков в интраоперационном и послеоперационном периодах. Ранее показано, что полиморфизм rs6746030 в значительной степени ассоциирован с восприятием боли при ряде патологических состояний, а клинические и экспериментальные исследования подтвердили аддитивную модель эффекта, при которой наиболее сильную боль ощущают носители генотипа AA, а наиболее слабую — носители генотипа GG [10, 13]. Тем не менее в данной работе отмечен абсолютно противоположный эффект, что требует в дальнейшем более тщательного изучения.

Не отмечалось статистически значимых различий между потреблением наркотических анальгетиков пациентами с различными генотипами при примерно одинаковой продолжительности операции и объеме кровопотери, однако при идентичном расходе анальгетиков в интраоперационном и послеоперационном периодах больные демонстрировали разные показатели по шкалам боли. В связи с этим в интраоперационном и послеоперационном периодах необходимо детально учитывать оценки по шкалам боли и в зависимости от этого менять количество анальгетиков. В основном в этих случаях применялись ненаркотические анальгетики и адъюванты для усиления обезболивания, которые могли несущественно менять интенсивность боли.

Хронической болью, согласно определению Международной ассоциации по изучению боли (IASP), считается болевое ощущение, которое продолжается сверх нормального периода заживления, как правило, продолжительностью более 3—6 мес [38]. Одним из ее главных отличий от острой боли является то, что хроническая боль очень трудно поддается лечению. Хроническая боль оказывает серьезное влияние на качество жизни (настроение, повседневную активность, сон, когнитивные функции и общественную жизнь). В связи с этим очень важно выделить индивидуальные особенности пациентов, которые относятся к группе риска развития таких неблагоприятных последствий ТЭПКС.

В этом исследовании ХПБ зарегистрирована у 3 из 21 пациента с гемофилией, перенесших ТЭПКС. При примерно одинаковом интраоперационном и послеоперационном расходах опиоидов боль в первые трое суток была интенсивнее у пациентов с хронической болью. У этих пациентов выявлена тенденция к нарастанию тревоги и депрессии в послеоперационном периоде. Следует отметить, что данное исследование является первым, которое направлено на определение взаимосвязи фенотипических и генотипических характеристик боли у пациентов с гемофилией. Вместе с тем оно имеет некоторые ограничения.

Ограничения исследования

Важно отметить ограничения данного исследования: это небольшая выборка и малое количество генов. Ограниченность выборки отчасти обусловлена тем, что гемофилия относится к редким врожденным нарушениям свертывания крови. Вероятно, дальнейшие исследования позволят идентифицировать новые клинические и генетические факторы, связанные с риском развития тяжелой острой и хронической боли, что приведет к созданию индивидуальных схем лечения боли, развитию индивидуального подхода, позволит уменьшить хроническую боль.

Несмотря на усилия по включению комплексных наборов психосоциальных, психофизических, генетических, клинических и демографических факторов, влияющих на восприятие боли, вполне возможно, что другие, нераспознанные факторы могут играть важную роль. В частности, исследование детерминант хронической боли после ТЭПКС является сложным из-за множества экологических и личностных факторов, которые могут повлиять на развитие боли в течение многих месяцев.

Другое ограничение метода заключается в том, что у ряда пациентов может наблюдаться сочетанный дефицит нескольких факторов, и хотя он встречается крайне редко, в дальнейшем для его диагностики и исключения таких пациентов из рассмотрения необходимо усложнить алгоритм обследования.

Заключение

Некоторые демографические, психологические и клинические факторы предсказывают развитие боли после тотального эндопротезирования коленных суставов. Тем не менее полный спектр факторов риска развития хронической послеоперационной боли в настоящее время неизвестен. Существует пробел знаний о генетических механизмах, лежащих в основе тяжелой послеоперационной и/или хронической боли, развивающейся после того, как выполнена стандартная хирургическая операция.

Подтверждается гипотеза о том, что на степень проявления болевых ощущений у больных гемофилией оказывают влияние определенные гены, контролирующие функции компонентов ноцицептивной сенсорной системы. Каждый отдельно взятый генетический вариант оказывает умеренное действие на восприятие боли, однако в совокупности они формируют разнообразие степени болевой чувствительности в мировой популяции. Вероятно, определение генотипа OPRM1 может дать больше информации о генетической предрасположенности к боли у больных гемофилией, чем генотипы COMT и SCN9A, и индуцировать дифференцированный подход к проведению аналгетической терапии.

Изучение влияния функциональных полиморфизмов в генах COMT, SCN9A на формирование психофизиологического профиля боли требует проведения дополнительных исследований на значительно большей выборке пациентов. Кроме того, следует изучить влияние и других генов, так как при формировании разных типов боли могут участвовать разные генетические факторы.

По данным настоящего исследования, хронический послеоперационный болевой синдром возникает у 14% пациентов с гемофилией, перенесших тотальное эндопротезирование коленных суставов. Нейропатический компонент боли после операции и интенсивная боль в раннем послеоперационном периоде могут являться предикторами хронического послеоперационного болевого синдрома.

Авторы заявляют об отсутствии конфликта интересов.

Подтверждение e-mail

На test@yandex.ru отправлено письмо с ссылкой для подтверждения e-mail. Перейдите по ссылке из письма, чтобы завершить регистрацию на сайте.

Подтверждение e-mail