Сайт издательства «Медиа Сфера»
содержит материалы, предназначенные исключительно для работников здравоохранения. Закрывая это сообщение, Вы подтверждаете, что являетесь дипломированным медицинским работником или студентом медицинского образовательного учреждения.

Мамедова Е.О.

ФГБУ "Эндокринологический научный центр" Минздрава РФ, Москва

Мокрышева Н.Г.

Эндокринологический научный центр, Москва

Пигарова Е.А.

ФГУ Эндокринологический научный центр Минздравсоцразвития РФ, Москва

Пржиялковская Е.Г.

ФГБУ "Эндокринологический научный центр" Минздрава РФ, Москва

Васильев Е.В.

ФГБУ «Эндокринологический научный центр», Москва

Петров В.М.

ФГБУ «Эндокринологический научный центр» Минздрава России, Москва, Россия

Дзеранова Л.К.

Эндокринологический научный центр Минздрава РФ, Москва

Молитвословова Н.Н.

ФГУ Эндокринологический научный центр Минздравсоцразвития Российской Федерации, Москва

Рожинская Л.Я.

ФГУ Эндокринологический научный центр, Москва

Тюльпаков А.Н.

Эндокринологический научный центр, Москва

Мельниченко Г.А.

ГБОУ ВПО «Первый Московский государственный медицинский университет им. И.М. Сеченова» Минздрава России, Москва, Россия

Фенокопии синдрома множественных эндокринных неоплазий 1-го типа: роль генов, ассоциированных с развитием аденом гипофиза

Авторы:

Мамедова Е.О., Мокрышева Н.Г., Пигарова Е.А., Пржиялковская Е.Г., Васильев Е.В., Петров В.М., Дзеранова Л.К., Молитвословова Н.Н., Рожинская Л.Я., Тюльпаков А.Н., Мельниченко Г.А.

Подробнее об авторах

Журнал: Проблемы эндокринологии. 2016;62(4): 4‑10

Просмотров: 460

Загрузок: 3

Как цитировать:

Мамедова Е.О., Мокрышева Н.Г., Пигарова Е.А., Пржиялковская Е.Г., Васильев Е.В., Петров В.М., Дзеранова Л.К., Молитвословова Н.Н., Рожинская Л.Я., Тюльпаков А.Н., Мельниченко Г.А. Фенокопии синдрома множественных эндокринных неоплазий 1-го типа: роль генов, ассоциированных с развитием аденом гипофиза. Проблемы эндокринологии. 2016;62(4):4‑10.
Mamedova EO, Mokrysheva NG, Pigarova EA, Przhiialkovskaia EG, Vasil’eva EV, Petrov VM, Dzeranova LK, Molitvoslovova NN, Rozhinskaia LIa, Tiul'pakov AN, Melnichenko GA. Phenocopies of multiple endocrine neoplasia type 1: role of the genes, associated with the development of pituitary adenomas. Problemy Endokrinologii. 2016;62(4):4‑10. (In Russ.).
https://doi.org/10.14341/probl20166244-10

?>

Синдром множественных эндокринных неоплазий 1-го типа (МЭН-1), проявляющийся сочетанным развитием первичного гиперпаратиреоза (ПГПТ), аденом гипофиза (АГ) и нейроэндокринных опухолей поджелудочной железы (НЭО ПЖ), возникает в результате герминальных мутаций в гене-супрессоре опухолевого роста MEN1. Клинический диагноз синдрома основывается на сочетании минимум двух из трех вышеперечисленных опухолей и должен быть подтвержден результатами молекулярно-генетического исследования [1].

В 10-30% семейных случаев МЭН-1 и до 90% спорадических случаев этого синдрома мутации в гене MEN1 методом прямого секвенирования по Сэнгеру не выявляются [2]. Синдром МЭН-1, диагностированный по клиническим признакам, но без выявленной мутации в гене MEN1, обозначается как фенокопия синдрома МЭН-1 [3-5]. Таким образом, с помощью молекулярно-генетического исследования можно подтвердить диагноз фенокопии синдрома МЭН-1 у пациента. В соответствии с существующими международными рекомендациями, отсутствие мутации в гене MEN1 исключает необходимость ежегодного скрининга с целью раннего выявления оставшихся компонентов синдрома у пациента и риск заболевания у родственников первой линии родства [1]. Однако могут иметь место мутации в некодирующих областях гена MEN1, крупные делеции гена или мутации в других, еще не установленных, генах [1].

Примерно в половине спорадических случаев МЭН-1 наблюдается сочетание АГ и ПГПТ; частота герминальных мутаций в гене MEN1 при таком сочетании в среднем составляет около 7%, что значительно ниже, чем при семейном МЭН-1 [2]. Примечательно, что у фенокопий МЭН-1 с сочетанием АГ и ПГПТ в подавляющем большинстве случаев встречаются соматотропиномы, а не пролактиномы, как при истинном МЭН-1 с мутацией в гене MEN1 [2, 6]. Кроме того, пациенты с фенокопиями МЭН-1 обычно старше пациентов с истинным МЭН-1 [2, 6]. При спорадическом сочетании АГ и НЭО ПЖ частота герминальных мутаций в гене MEN1 также составляет около 7% [2].

Механизмы возникновения фенокопий МЭН-1 изучены недостаточно. Сочетанное развитие АГ и ПГПТ (и/или НЭО ПЖ) может объясняться следующими причинами: 1) мутациями в генах (возможно, еще неизученных), приводящими к одновременному развитию АГ и ПГПТ (и/или НЭО ПЖ); 2) мутациями в генах, приводящими к семейным формам АГ, при сочетании со спорадическим ПГПТ (и/или НЭО ПЖ) или мутациями в генах, приводящими к семейным формам ПГПТ, при сочетании со спорадическими АГ (и/или НЭО ПЖ); 3) бигенным заболеванием, когда у одного и того же пациента или одной семьи имеются мутации в двух генах, приводящие к развитию семейных форм АГ и семейных форм ПГПТ; 4) развитием АГ и ПГПТ (и/или НЭО ПЖ) у одного и того же пациента вследствие случайного спорадического сочетания. Исключение наследственной природы сочетания нескольких эндокринных неоплазий крайне важно для определения тактики ведения пациента и обследования родственников первой линии родства.

Цель исследования - определить роль генов, ассоциированных с развитием наследственных АГ, а также генов, возможно вовлеченных в патогенез спорадических АГ, в развитии фенокопий синдрома МЭН-1, одним из компонентов которых является АГ.

Материал и методы

В исследование были включены 23 пациента с клиническим диагнозом синдрома МЭН-1, наблюдавшихся в отделении нейроэндокринологии и остеопатий ФГБУ «Эндокринологический научный центр» Минздрава России. С учетом цели исследования, одним из компонентов синдрома МЭН-1 у 22 пациентов была АГ. В исследование была включена также 1 пациентка с краниофарингиомой, что обосновывалось наличием у нее двух других компонентов синдрома МЭН-1 (ПГПТ и НЭО ПЖ), а также особенностью эмбрионального развития краниофарингиомы из клеток-предшественников аденогипофиза. Кроме того, у 1 пациентки имело место не классическое для МЭН-1 сочетание опухолей, а сочетание АГ и феохромоцитомы. Диагнозы А.Г., ПГПТ и НЭО ПЖ установливались в соответствии со стандартными алгоритмами [1]. Во всех случаях отсутствовали надежные данные о наличии АГ, ПГПТ, НЭО ПЖ или синдрома МЭН-1 у родственников первой линии родства. Критерием исключения являлись выявленные ранее секвенированием по Сэнгеру мутации в гене MEN1. Все пациенты подписывали информированное согласие на участие в исследовании.

Всем пациентам было проведено исследование панели генов-кандидатов, включающей гены, герминальные мутации в которых могут приводить к развитию наследственных АГ (MEN1, CDKN1B, PRKAR1A, AIP); гены, мутации в которых могут приводить к сочетанному образованию АГ и феохромоцитом/параганглиом (SDHA, SDHB, SDHC, SDHD), а также некоторые гены, в которых были выявлены соматические мутации, или изменение экспрессии которых было зафиксировано в тканях спорадических АГ (GNAS, PRKCA, CDKN2A, CDKN2C, POU1F1, PTTG2) [7]. Панель праймеров для мультиплексной амплификации вышеперечисленных генов (207 ампликонов) была создана с помощью программы Ion AmpliSeqTM Designer (https://www.ampliseq.com). Геномная ДНК была выделена из цельной крови с использованием набора MagNA Pure LC DNA Isolation Kit I (Roche Diagnostics, Швейцария) с помощью MagNA Pure LC 2.0 Instrument («Roche Diagnostics», Швейцария). В дальнейшем были проведены этапы подготовки проб перед высокопроизводительным параллельным секвенированием (next-generation sequencing - NGS) и собственно NGS на секвенаторе Ion TorrentTM PGMTM (Thermo Fisher Scientific - Life Technologies, США) в соответствии со стандартными протоколами (доступны на сайте https://ioncommunity.thermofisher.com/community/protocols-home или по запросу). Анализ данных NGS проводился с помощью программного обеспечения Torrent SuiteTM (Thermo Fisher Scientific - Life Technologies, США). Аннотирование выявленных изменений проводилось с помощью программы ANNOVAR (http://annovar.openbioinformatics.org) [8]. В качестве референсной последовательности генов MEN1, CDKN1B, PRKAR1A, AIP, SDHA, SDHB, SDHC, SDHD, GNAS, PRKCA, CDKN2A, CDKN2C, POU1F1, PTTG2 использовалась ссылка Genbank (http://www.ncbi.nlm.nih.gov/genbank/) под номерами NM_130799.2, NM_004064.4, NM_002734.4, NM_003977.3, NM_004168.3, NM_003000.2, NM_003001.3, NM_003002.3, NM_000516.4, NM_002737.2, NM_000077.4, NM_001262.2, NM_000306.3, NM_006607 соответственно.

Результаты

Клинические характеристики пациентов представлены в таблице. Среди пациентов преобладали женщины (соотношение 10:1). У большинства пациентов (n=20) имелось сочетание АГ и ПГПТ, у 1 пациентки (№ 23) - сочетание краниофарингиомы, ПГПТ и НЭО ПЖ, у 1 пациента (№ 14) - АГ и НЭО ПЖ, у 1 пациентки (№ 22) - АГ и феохромоцитомы правого надпочечника.

Клиническая характеристика пациентов с фенокопиями синдрома МЭН-1 Примечание. *Указаны: тип секреции; размер и характер роста; наличие ремиссии; возраст на момент дебюта/выявления (годы). ** Указаны: наличие (+ есть, – нет); возраст на момент дебюта/выявления (годы). ^ Пациенты с НЭО ПЖ. ~ Пациентка с феохромоцитомой правого надпочечника. ° См. объяснение в тексте. Сокращения: СТГ - соматотропный гормон; ПРЛ - пролактин; АКТГ - аденокортикотропный гормон; ГНАГ - гормональнонеактивная АГ; микро- - микроаденома; макро- - макроаденома; характер роста: (э) - эндоселлярный, (п) - параселлярный (D - в правый кавернозный синус, S - в левый кавернозный минус), (р) - ретроселлярный, (и) - инфраселлярный, (а) - антеселлярный; АС - аналоги соматостатина длительного действия; АД - агонисты дофамина; Р - ремиссия; МР - медикаментозная ремиссия; НР - нет ремиссии; ТТА - трансназальная транссфеноидальная аденомэктомия; ТКА - транскраниальная аденомэктомия; ГТ - гамма-терапия; ЛТ - лучевая терапия (Novalis); НО - не оперирован.

Среди АГ преобладали соматотропиномы (n=16; 73%); остальные типы АГ были представлены единичными случаями: смешанная СТГ/ПРЛ-секретирующая АГ - 2 (9%), пролактинома - 1 (4,5%), кортикотропинома - 2 (9%), гормональнонеактивная АГ (ГНАГ) - 1 (4,5%). Информация о типе секреции, характере роста АГ, проведенном лечении, наличии ремиссии и возрасте дебюта АГ представлена в таблице. АГ были первым клиническим проявлением у 20 (91%) пациентов. У пациентки № 23 первым клиническим проявлением была краниофарингиома. Дебютом заболевания считали возраст появления клинических признаков АГ или их выявления АГ (при отсутствии клинических признаков).

ПГПТ был диагностирован у 21 из 23 пациентов на основании минимум двукратного определения повышенного уровня кальция и паратгормона (ПТГ) в крови. В большинстве случаев ПГПТ диагностировался позже АГ (90%). У 2 пациенток (№ 1 и № 13) ПГПТ был выявлен раньше АГ (при обследовании по поводу мочекаменной болезни). У пациентки № 13 мочекаменная болезнь дебютировала в 25 лет, однако диагноз ПГПТ был установлен лишь в возрасте 57 лет.

У 2 пациентов были клинически диагностированы гормональнонеактивные НЭО ПЖ. У пациентки № 23 имелось сочетание краниофарингиомы, ПГПТ и НЭО ПЖ. С помощью мультиспиральной компьютерной томографии (МСКТ) в хвосте ПЖ было выявлено гиперваскуляризованное образование размером 1,3×1,2×1,5 см, в теле железы - гиперваскуляризованное образование размером 0,6×0,6×0,8 см (по характеристикам контрастного усиления, наиболее вероятно - НЭО). У пациента № 7 при МСКТ в хвосте ПЖ было выявлено объемное образование низкой плотности диаметром 2,4 см, состоящее из мягкотканного и кистозного компонента. Была проведена корпорокаудальная резекция ПЖ (60%), спленэктомия, холецистэктомия (гистологически - серозная микрокистозная аденома диаметром 2 см и нейроэндокринная микроаденома диаметром 5 мм).

У пациентки № 22, по данным МСКТ забрюшинного пространства, имелось объемное образование кистозно-солидной структуры правого надпочечника (3,2×3,3×3,6 см, плотность 36 НU) и образование левого надпочечника (0,86×0,87 см, плотность 11 НU). В моче выявлено повышение уровня метанефрина - 1647 мкг/сут (норма 25-312 мкг/сут), норметанефрина - 604 мкг/сут (норма 35-445 мкг/сут), что подтверждало диагноз феохромоцитомы (вероятно, правого надпочечника, поскольку эта опухоль имела большие размеры и высокую плотность, тогда как образование левого надпочечника представляло собой скорее гормональнонеактивную опухоль). У некоторых пациентов имелись также другие эндокринные и неэндокринные новообразования: рак молочной железы (№ 1), рак почки (№ 12), злокачественная опухоль забрюшинного пространства (№ 20), гемангиома кожи стопы (№ 3), гемангиома тела поясничного позвонка (№ 17), липомы кожи (№ 14), опухоль яичника (№ 13), ангиолипома почки (№ 6), одно- и двусторонние гормональнонеактивные опухоли надпочечников (№ 2, 5, 6, 14, 17, 20), макронодулярная гиперплазия надпочечников (№ 11).

По данным NGS, ни у одного из пациентов мутации в гене MEN1 выявлены не были, что подтверждает диагноз фенокопий синдрома МЭН-1. У 1 пациентки (№ 13) с макросоматотропиномой и висцеральной формой ПГПТ была выявлена герминальная гетерозиготная замена (миссенс-мутация) в экзоне 6 гена AIP c.911G>A (p.R304Q).

У 4 пациентов были выявлены полиморфизмы, патологическая значимость которых не определена: у пациентки № 17 с макросоматотропиномой и костно-висцеральной формой ПГПТ - гетерозиготная замена p. R45H (c.134G>A) в экзоне 1 гена PTTG2, у пациентки № 20 с ГНАГ и костно-висцеральной формой ПГПТ - гетерозиготная замена в интроне 1 гена PRKAR1A (c.-10G>C), у пациентки № 6 с микросоматотропиномой и мягкой формой ПГПТ - гетерозиготная замена в экзоне 5 гена SDHB p. S163P (c.487T>C), у пациентки № 10 с макросоматотропиномой и мягкой формой ПГПТ - гетерозиготная замена в 3’-UTR гена CDKN1B g.3897G>T (c*8G>T).

Обсуждение

АГ могут развиваться в рамках некоторых наследственных синдромов, к которым, помимо синдрома МЭН-1, относят синдром множественных эндокринных неоплазий 4-го типа (МЭН-4), Карни комплекс (CNC), семейные изолированные аденомы гипофиза (FIPA) [7, 9]. Указанные синдромы развиваются вследствие герминальных мутаций в генах CDKN1B, PRKAR1A и AIP соответственно [7, 9]. Следует отметить, что герминальные мутации в гене AIP выявляются только в 10% случаев FIPA, причина развития остальных FIPA до настоящего времени не установлена [10].

Синдромы семейных параганглиом/феохромоцитом типов 5, 4, 3 и 1 обусловлены мутациями в генах, кодирующих 4 субъединицы митохондриального комплекса сукцинатдегидрогеназы (SDHA, SDHB, SDHC и SDHD), соответственно. Показано, что мутации в этих генах иногда выявляются у пациентов с сочетанием АГ и параганглиом/феохромоцитом, что делает вероятным их участие в формировании АГ [11, 12]. В последнее время описано несколько пациентов с мутациями в гене рибонуклеазы - DICER1 (преимущественно дети с болезнью Кушинга вследствие бластом/аденом гипофиза, плевропульмональными бластомами и другими опухолями), однако роль таких мутаций в формировании АГ изучена мало [7, 9]. Подробное описание перечисленных наследственных синдромов выходит за рамки данной статьи; детальная информация представлена в ряде отечественных и зарубежных публикаций [7, 9-12].

При исследовании спорадических АГ были выявлены как соматические мутации в некоторых генах (GNAS, PRKCA, MEN1 и др.), так и изменения экспрессии ряда генов в ткани АГ (PRKCA, CDKN2A, CDKN2C, POU1F1 и др.), однако неясно являются ли они триггером образования АГ или возникают позднее уже в ткани АГ [7].

В нашем исследовании только у 1 (4%) из 23 пациентов с фенокопиями МЭН-1 была обнаружена герминальная гетерозиготная замена (возможно, миссенс-мутация) в гене AIP. Выявленная замена p. R304Q описана ранее у пациентки из Польши со спорадической кортикотропиномой, манифестировавшей в возрасте 26 лет [13]. Доказательство патогенности миссенс-мутаций всегда представляет трудности, однако выявленная нами мутация может считаться патогенной по нескольким алгоритмам in silico. Распространенность указанной мутации в популяции неизвестна. Примечательно, что в литературе была описана мутация со сдвигом рамки считывания в гене AIP (c.825_845delCGCGGCCGTGTGGAATGCCCA, p. His275GlnfsX49) у пациента с акромегалией, диагностированной в 23 года, и ПГПТ, диагностированным в 29 лет, по поводу которого было удалено солитарное образование околощитовидной железы [14]. Кроме того, описаны герминальные миссенс-мутации (возможно, полиморфизмы) в гене AIP у пациенток пожилого возраста со спорадическим ПГПТ без АГ [15]. Таким образом, выявленная нами гетерозиготная замена в гене AIP может рассматриваться либо как причина FIPA в сочетании со спорадическим ПГПТ, либо как причина и соматотропиномы и ПГПТ, либо как полиморфизм. В дальнейшем планируется обследование родственников первой линии родства пациентки № 11 для выявления носителей мутации и определения их фенотипических проявлений.

Выявленная гетерозиготная замена p. R45H (c.134G>A) в экзоне 1 гена PTTG2 у пациентки № 17 предсказана полиморфизмом по нескольким in silico алгоритмам. Кроме того, аргинин в положении 45 не является консервативным. Ген PTTG2 входит в семью генов PTTG (pituitary tumor transforming genes), включающую также гены PTTG1 и PTTG3, которые относятся к семейству секуринов, необходимых для регуляции расхождения сестринских хроматид во время митоза. Можно ожидать повышения экспрессии PTTG в опухолях различных типов. В ряде исследований установлено, что уровень мРНК PTTG в соматотропиномах выше, чем в ГНАГ, но в кортикотропиномах, пролактиномах и соматотропиномах статистически не различаются. Также показано, что экспрессия PTTG в гормональноактивных инвазивных АГ выше, чем в их неинвазивных аналогах [16]. Пациентка № 17 характеризовалась рядом особенностей. Помимо А.Г. и ПГПТ, у нее имелись аденокарцинома правой почки и многоузловой токсический зоб, двусторонние гормональнонеактивные образования надпочечников, гемангиомы тела L3, кисты левой почки. В раннем послеоперационном периоде после трансназальной транссфеноидальной аденомэктомии, по поводу макросоматотропиномы, у нее развились клинические признаки надпочечниковой недостаточности (выраженная слабость, отсутствие аппетита, тошнота, рвота, гипотония); при этом в крови отмечалось парадоксальное повышение утреннего кортизола (> 1750 нмоль/л при норме 123-626 нмоль/л) и кортизола в вечерней слюне (121,9 нмоль/л; норма 0,5-9,4 нмоль/л) на фоне нормальной концентрации АКТГ (47,9 пг/мл), гипокалиемия (2,5 ммоль/л при норме 3,5-5,1 ммоль/л) и значительное снижение почечной функции (скорость клубочковой фильтрации - 30 мл/мин/1,73 м2). После внутримышечного введения препаратов глюкокортикоидов самочувствие пациентки значительно улучшилось.

В настоящее время описано около 10 сплайсинговых мутаций в гене PRKAR1A, преимущественно у пациентов с Карни комплексом, а также синдромом Кушинга вследствие первичной пигментной нодулярной гиперплазии коры надпочечников [17]. В нашем исследовании гетерозиготная замена в интроне 1 гена PRKAR1A (c.-10G>C) была выявлена у пациентки с гормональнонеактивной эндопараинфраселлярной макроаденомой гипофиза, костной формой ПГПТ и гормональнонеактивным образованием правого надпочечника. В анамнезе пациентки артериальная гипертензия кризового течения с 36 лет, объемное образование левого надпочечника, по поводу которого в возрасте 47 лет проведена левосторонняя адреналэктомия (гистологическое заключение: аденоматозная ткань, гормональные исследования перед операцией не проводились), а также злокачественная опухоль забрюшинного пространства, по поводу которой проведены экстирпация матки с правым придатком, экстирпация прямой кишки с забрюшинной опухолью (результаты гистологического заключения не предоставлены).

Гетерозиготная замена в гене SDHB p. S163P (c.487T>C), обнаруженная у пациентки с микросоматотропиномой и мягкой формой ПГПТ, встречается в европейской популяции с частотой 1,7%. Такая замена описана как полиморфизм у пациента с медуллярным раком щитовидной железы [18]. Герминальные мутации в гене SDHB приводят к развитию синдрома семейных параганглиом/феохромоцитом типа 4. К 2015 г. описано 6 пациентов с мутациями в гене SDHB, у которых АГ сочетались с феохромоцитомами/параганглиомами [11]. Примечательно, что у пациентки № 22 с акромегалией и феохромоцитомой правого надпочечника мутации в генах SDHA, SDHB, SDHC, SDHD не были обнаружены.

Ни у одного из пациентов с фенокопиями МЭН-1 мы не выявили мутаций в экзонах гена CDKN1B (характерных для синдрома МЭН-4), что подтверждает данные о незначительном вкладе таких мутаций в развитие фенокопий МЭН-1 [2, 19]. У пациентки № 9 была выявлена замена в 3’-UTR гена CDKN1B g.3897G>T (c.*8G>T)), однако ее патологическая значимость не доказана.

Как уже отмечалось, среди АГ у наших пациентов с фенокопиями МЭН-1 преобладали соматотропиномы, что соответствует данным литературы [2]. Сочетание акромегалии и ПГПТ может объясняться и тем, что при акромегалии возрастает частота новообразований (преимущественно щитовидной железы и желудочно-кишечного тракта) [20]. Не исключено, что и ПГПТ может быть обусловлен длительным действием избытка инсулиноподобного фактора роста 1 на околощитовидные железы. Однако данная теория не объясняет возникновение ПГПТ у пациентов с фенокопиями МЭН-1 в сочетании с другими АГ (пролактиномами, кортикотропиномами и ГНАГ). Также необходимо учитывать, что ПГПТ встречается в общей популяции (преимущественно у женщин в постменопаузе) достаточно часто, тогда как частота АГ значительно меньше, а НЭО ПЖ – крайне редки [5, 21]. Тем не менее возможно случайное сочетание двух новообразований у одного пациента. Возможно также существование других генов (в том числе еще не идентифицированных), мутации в которых могут приводить к сочетанию АГ с ПГПТ и/или с НЭО ПЖ.

Заключение

Мутации в большинстве известных генов, ассоциированных с формированием наследственных и спорадических АГ, не обусловливают развитие фенокопий синдрома МЭН-1. Необходимость прицельного исследования гена AIP у всех пациентов с фенокопиями этого синдрома требует дальнейшего обоснования. Для исключения патологической роли выявленных изменений в генах PTTG2, PRKAR1А, 3’-UTR CDKN1B необходимы исследования с применением молекулярно-биологических методов. Равно необходим поиск новых генов, мутации в которых могли бы быть причиной формирования фенокопий синдрома МЭН-1.

Благодарности

Мы благодарим врачей отделения нейроэндокринологии и остеопатий ФГБУ «Эндокринологический научный центр» Минздрава Росиии за активное участие и помощь в проведении исследования (Ж.Е. Белая, С.Д. Арапова, Т.С. Зенкова, Е.И. Марова).

Работа выполнена при поддержке гранта Президента Российской Федерации № МК-5411.2014.7 «Молекулярно-генетические основы семейных аденом гипофиза».

Участие авторов: концепция и дизайн исследования - Н.Г. Мокрышева, Л.К. Дзеранова, Е.А. Пигарова, Л.Я. Рожинская, А.Н. Тюльпаков; сбор и обработка материала - Е.О. Мамедова, Е.А. Пигарова, Е.Г. Пржиялковская, Е.В. Васильев, В.М. Петров, Н.Н. Молитвословова, Л.К. Дзеранова, Н.Г. Мокрышева; статистическая обработка данных - Е.О. Мамедова, Е.В. Васильев, В.М. Петров; написание текста - Е.О. Мамедова; редактирование - Н.Г. Мокрышева, Е.А. Пигарова, Е.Г. Пржиялковская, Н.Н. Молитвословова, Л.К. Дзеранова, Л.Я. Рожинская, А.Н. Тюльпаков, Г.А. Мельниченко

Подтверждение e-mail

На test@yandex.ru отправлено письмо с ссылкой для подтверждения e-mail. Перейдите по ссылке из письма, чтобы завершить регистрацию на сайте.

Подтверждение e-mail