Сайт издательства «Медиа Сфера»
содержит материалы, предназначенные исключительно для работников здравоохранения. Закрывая это сообщение, Вы подтверждаете, что являетесь дипломированным медицинским работником или студентом медицинского образовательного учреждения.

Тюльпаков А.Н.

Эндокринологический научный центр, Москва

Калинченко Н.Ю.

Эндокринологический научный центр, Москва

Клиническая и молекулярно-генетическая характеристика 10 случаев врожденной гипоплазии надпочечников, обусловленной дефектами фактора DAX1

Авторы:

Тюльпаков А.Н., Калинченко Н.Ю.

Подробнее об авторах

Журнал: Проблемы эндокринологии. 2010;56(2): 3‑9

Просмотров: 617

Загрузок: 16

Как цитировать:

Тюльпаков А.Н., Калинченко Н.Ю. Клиническая и молекулярно-генетическая характеристика 10 случаев врожденной гипоплазии надпочечников, обусловленной дефектами фактора DAX1. Проблемы эндокринологии. 2010;56(2):3‑9.
Tiul'pakov AN, Kalinchenko NIu. Clinical and molecular genetic characteristic of 10 cases with congenital adrenal hypoplasia caused by DAX-1 gene defects. Problemy Endokrinologii. 2010;56(2):3‑9. (In Russ.).

?>

Врожденная гипоплазия надпочечников (ВГН) — группа заболеваний, характеризующихся врожденным нарушением формирования и/или развития коркового слоя надпочечников. Патогенетически гипоплазия коркового вещества надпочечников может развиваться как вследствие недостаточной ее стимуляции адренокортикотропным гормоном (АКТГ), например при врожденном гипопитуитаризме, так и в результате первичного дефекта закладки коркового вещества надпочечников. По характеру наследования различают аутосомно-рецессивные и X-сцепленную формы ВГН.

В структуре ВГН X-сцепленная форма является наиболее распространенной и изученной. Ее причиной служат дефекты гена NR0B1, располагающегося на хромосоме Xp21 и кодирующего белок DAX1. DAX1 — фактор транскрипции, играющий ключевую роль в развитии коркового вещества надпочечников и гипоталамо-гипофизарно-гонадной системы. Дефицит белка DAX1 проявляется надпочечниковой недостаточностью, возникающей в большинстве случаев в раннем детском возрасте, и гипогонадотропным гипогонадизмом, проявляющимся в пубертатном периоде. Как и другие заболевания с рецессивным X-сцепленным наследованием, ВГН вследствие дефицита DAX1 проявляется клинически только у мальчиков. В отечественной литературе описания случаев ВГН отсутствуют. Ниже мы приводим наблюдения 10 пациентов с X-сцепленной формой ВГН. Во всех представленных случаях диагноз ВГН был подтвержден молекулярно-генетически.

Методы исследования и клиническое описание случаев

Молекулярно-генетические исследования. Геномную ДНК выделяли из периферических лейкоцитов с использованием стандартных методов. С помощью полимеразной цепной реакции (ПЦР) амплифицировали 2 фрагмента геномной ДНК (1270 и 425 пар нуклеотидов), охватывающие соответственно кодирующие последовательности экзонов 1 и 2 гена NR0B1 с примыкающими участками интрона (см. рисунок).

Рисунок 1. Структура гена NR0B1 и белка DAX1, а также локализация мутаций, выявленных у 10 пациентов с врожденной гипоплазией надпочечников. Стрелками показаны места отжига олигонуклеотидов, использовавшихся для ПЦР и последующего секвенирования. ДСД — ДНК-связывающий домен; ЛСД — лиганд-связывающий домен.
После электрофореза в 1% агарозном геле продукты ПЦР выделяли и очищали с использованием набора Wizard PCR Preps DNA Purification System (Promega, США), а затем секвенировали на автоматическом секвенаторе Genetic Analyzer Model 3130 (Applied Biosystems, США).

При проведении ПЦР и последующем секвенировании применяли следующие олигонуклеотиды (см. рисунок):

E1F, 5’— GAGGCAGCCACTGGGCAGAAC—3’;

E1R, 5’— GCACTGCCCGATGCTTTTGTG—3’;

E2F, 5’— CCGGGAAGCTTTGGGTCTTG—3’;

E2R, 5’— CCACAGCTCTTTATTCTTCCCTCATG —3’

В качестве референсной последовательности гена NR0B1 использовали ссылку Genbank под номером U31929. Обозначение мутаций проводили в соответствии с рекомендациями J. den Dunnen, S. Antonarakis [1].

Клиническое описание случаев. Во всех случаях поводом для эндокринологического обследования были проявления надпочечниковой недостаточности, возраст манифестации которой варьировал от 2 нед до 13 лет. Анализ семейного анамнеза позволил предположить случаи надпочечниковой недостаточности у родственников обследуемых в 6 из 10 случаев.

Ниже приводим краткие описания клинических случаев (см. таблицу).

№1. Ребенок от вторых родов. Семейный анамнез отягощен: первый ребенок (мальчик) и дядя по материнской линии умерли в конце первого месяца жизни на фоне симптомов, похожих на проявления острой надпочечниковой недостаточности. При рождении выявлен двусторонний паховый крипторхизм. Со 2-й недели жизни отмечены плохая прибавка массы тела, срыгивания, гиперпигментация. При госпитализации в возрасте 3 нед выявлены гипонатриемия (120 ммоль/л) и гиперкалиемия (6,2 ммоль/л), диагностирована сольтеряющая форма врожденной дисфункции коры надпочечников (ВДКН) и назначена терапия глюко- и минералокортикоидами. ВГН была предположительно диагностирована в возрасте 12 лет в связи с отягощенным семейным анамнезом и отсутствием повышения уровня 17-оксипрогестерона (17OHP) при динамическом наблюдении. В 18 лет подтвержден гипогонадотропный гипогонадизм: тестостерон — 2,5 нмоль/л, лютеинизирующий гормон (ЛГ) — 0,2 МЕ/л, фолликулостимулирующий гормон (ФСГ) — 1,3 МЕ/л; назначена терапия андрогенами. При исследовании гена NR0B1 выявлена гемизиготная делеция 7 оснований в позиции 968—974, что приводило к замене кодона треонина (ACC) на серин (AGC) в позиции 324, сдвигу рамки считывания и образованию преждевременного стоп-кодона в позиции 369 (p.T324SfsX369).

№2. Ребенок от первых родов. Семейный анамнез не отягощен. Со 2-й недели жизни отмечены плохая прибавка массы тела, эпизодические срыгивания. При стационарном обследовании в возрасте 3 мес выявлены гипонатриемия (126 ммоль/л) и гиперкалиемия (6,0 ммоль/л), при этом уровень 17OHP повышен не был (2,3 нг/мл). Диагностирован первичный врожденный гипокортицизм (ВГН рассматривался как один из возможных диагнозов) и назначено лечение глюко- и минералокортикоидами. ВГН верифицирована данными молекулярно-генетического исследования в возрасте 13 лет. С 18 лет в связи с отсутствием спонтанного пубертата к лечению добавлена терапия андрогенами. При исследовании гена NR0B1 выявлена гемизиготная замена основания G на A в позиции 873, что приводило к замене кодона триптофана (TGG) на стоп-кодон (TGA) в позиции 291 (p.W291X).

№3. Ребенок от вторых родов. У старшего брата (пациент №4) — ВГН (манифестация с 13 лет). С 5 лет отмечены эпизоды слабости, боли в животе, повышенная потребность в поваренной соли, гиперпигментация кожи, периодические рвоты. В возрасте 4 лет 6 мес госпитализирован в сопорозном состоянии, при обследовании выявлены гипонатриемия (113 ммоль/л) при нормальном уровне калия (4,8 ммоль/л) и выраженная гипогликемия (1,8 ммоль/л). Диагностирован первичный гипокортицизм, назначено лечение глюко- и минералокортикоидами. ВГН предположена в возрасте 16 лет, после того как данный диагноз был предположен у старшего брата. При проведении пробы с аналогом ЛГ-рилизинг-гормона (бусерелин) в возрасте 16 лет максимальный уровень ЛГ был отмечен через 4 ч после стимуляции и составил 7,5 МЕ/л, уровень тестостерона через 24 ч повысился до 5,3 нмоль/л (базальный 2,2 нмоль/л). С 16,5 лет к заместительной терапии добавлены препараты тестостерона. При исследовании гена NR0B1 выявлена гемизиготная замена основания C на A в позиции 129, что приводило к замене кодона цистеина (TGC) на стоп-кодон (TGA) в позиции 43 (p.C43X).

№4. Ребенок от первых родов. У младшего брата (пациент №3) ВГН. С 13 лет на фоне интеркурентного заболевания отмечены выраженная слабость, многократная рвота, гиперпигментация кожи. В связи с ранее выявленным заболеванием у брата (см. выше) диагностирован гипокортицизм, назначено лечение глюко- и минералокортикоидами. При обследовании в ЭНЦ в возрасте 19 лет половое развитие соответствовало стадии P1G1 по Таннеру, объем яичек 4 мл, уровень тестостерона составил 1,2 нмоль/л, ЛГ — 5,5 МЕ/л, ФСГ — 4,7 МЕ/л; диагностирован гипогонадотропный гипогонадизм, начато лечение хорионическим гонадотропином и андрогенами. Сочетание надпочечниковой недостаточности и гипогонадизма (а также наличие сходной симптоматики у брата) позволило предположить ВГН. При исследовании гена NR0B1 выявлена гемизиготная замена основания C на A в позиции 129, что приводило к замене кодона цистеина (TGC) на стоп-кодон (TGA) в позиции 43 (p.C43X).

№5. Ребенок от первых родов. Семейный анамнез не отягощен. Раннее развитие без особенностей. В возрасте 8 лет 3 мес после летнего периода отмечено стойкое потемнение кожных покровов. В последующем в течение 2 лет наблюдалось несколько эпизодов ухудшения состояния, протекавших с тошнотой, рвотой, адинамией, нарушением ритма сердца, фебрилитетом, помрачением сознания и расцененных как проявления нейроинфекции. В возрасте 10 лет во время аналогичного ухудшения состояния выявлены гиперкалиемия и гипонатриемия, диагностирован гипокортицизм и назначено лечение глюко- и минералокортикоидами. При обследовании в ЭНЦ в возрасте 16 лет 6 мес (преднизолон 3,75 мг/сут, кортинефф 0,1 мг/сут): евнухоидные пропорции тела, рост 168,6 см (SDS –0,7), масса тела 55,5 кг; половое развитие: Таннер 1, яички 3 и 4 мл; костный возраст 12 лет; максимальный уровень ЛГ и ФСГ на пробе с бусерелином 42,5 и 38,5 МЕ/л соответственно. Тестостерон: базальный — 0,7 нмоль/л, после стимуляции хорионическим гонадотропином — 5,5 нмоль/л. При обследовании в возрасте 18 лет в связи с отсутствием спонтанного пубертата диагностирован гипогонадизм, назначена заместительная терапия препаратами тестостерона. Сочетание первичного гипокортицизма и гипогонадизма позволило предположить ВГН. При исследовании гена NR0B1 выявлена гемизиготная делеция основания T в позиции 1326, что приводило к замене кодона аспарагина (AAT) на лизин (AAG) в позиции 442, сдвигу рамки считывания и образованию преждевременного стоп-кодона в позиции 461 (p.N442K fs X461).

№6. Ребенок от вторых срочных родов. Семейный анамнез точно не известен. В течение первых 2 лет жизни наблюдалось снижение темпов физического развития. С 6 лет отмечались эпизоды слабости, головокружений, тошнота. В возрасте 12 лет 3 мес обратились к эндокринологу с жалобами на задержку роста (SDS –1,6). При обследовании отмечена смуглость кожи, уровень глюкозы в крови и электролиты в пределах нормы. В 13 лет 5 мес в связи с усилением гиперпигментации кожи и повторными эпизодами слабости и рвоты проведено эндокринологическое обследование и выявлено снижение базального (88 нмоль/л) и стимулированного АКТГ (166 нмоль/л) уровней кортизола сыворотки. Диагностирован первичный гипокортицизм и назначено лечение ацетатом кортизона. При обследовании в ЭНЦ в возрасте 14 лет (на фоне лечения ацетатом кортизона 25 мг/сут): рост 139,8 см (SDS –2,4), масса тела 31,5 кг; половое развитие: Таннер 1, яички 4 мл; гормоны крови: кортизол <50 нмоль/л, АКТГ >1365 пг/мл, альдостерон 32 пмоль/л, активность ренина в плазме 31 нг/мл/ч. Максимальные уровни ЛГ и ФСГ при пробе с бусерелином — 6,2 и 3,6 МЕ/л соответственно. Тестостерон: базальный — 0,7 нмоль/л, после стимуляции хорионическим гонадотропином — 9,1 нмоль/л. При исследовании гена NR0B1 выявлена гемизиготная замена основания A на C в позиции 848, что приводило к замене кодона глутамина (CAG) на кодон пролина (CCG) в позиции 283 (p.Q283P).

№7. Ребенок от второй беременности (от первой беременности здоровая девочка). Роды в срок, масса тела 3670 г, длина 58 см. С рождения выявлен левосторонний крипторхизм. С 1 мес жизни плохая прибавка массы тела, гиперпигментация кожи, периодические срыгивания. В возрасте 3 мес фебрильные судороги. При госпитализации по месту жительства диагностирована ВДКН (без определения 17OHP), назначено лечение глюко- (преднизолон) и минералокортикоидами (кортинефф). В ходе динамического наблюдения ни разу не отмечалось повышения уровня 17OHP. Обследован в ЭНЦ в возрасте 6 лет (лечение: преднизолон 2,5 мг/сут, кортинефф 0,05 мг/сут): рост 111,8 см (SDS –0,5), масса тела 19,5 кг. Таннер 1, яички 2 мл, паховая ретенция слева. Низкие уровни 17OHP и наличие крипторхизма позволили предположить ВГН. При исследовании гена NR0B1 выявлена гемизиготная миссенс-мутация: замена основания T на G в позиции 785, что приводило к замене кодона лейцина (CTG) на аргинин (CGG) в позиции 262 (p.L262R).

№8. Ребенок от третьей беременности. Первые 2 беременности от другого брака: ребенок от первой беременности (мальчик) умер в возрасте 8 мес (диагноз точно установлен не был, предположительно адреногенитальный синдром), ребенок от второй беременности (мальчик) умер в возрасте 1 года 3 мес (причина — «апноэ во сне»?). С первого месяца жизни отмечены жалобы на плохую прибавку массы тела, диарею. При обследовании по месту жительства выявлено повышение уровня калия (6,3 ммоль/л) при нормальном содержании натрия (135 ммоль/л), умеренное повышение уровня 17OHP (11,7 нмоль/л, при норме до 6,2 нмоль/л) и значительное повышение уровня АКТГ (254 пг/мл при норме до 46 пг/мл). На основании полученных данных была диагностирована сольтеряющая форма ВДКН и начата терапия глюко- (кортеф) и минералокортикоидами (кортинефф). В процессе динамического наблюдения обращало внимание, что уровни 17OHP были всегда снижены, даже при высоких уровнях АКТГ. С учетом низких уровней 17OHP и нетипичной для аутосомно-рецессивного наследования родословной диагноз ВДКН был подвергнут сомнению и предположена ВГН. Обследован в ЭНЦ в возрасте 3 лет (лечение: кортеф 3,75 мг/сут, кортинефф 0,05 мг/сут): рост 100 см (SDS 1,6), масса тела 26,2 кг; Таннер 1, яички 1 мл. При исследовании гена NR0B1 выявлена гемизиготная делеция основания A в позиции 501, что приводило к замене кодона аланина на глицин в позиции 169, сдвигу рамки считывания и образованию преждевременного стоп-кодона в позиции 200 (p.A169GfsX200).

№9. Ребенок от первой беременности. Роды путем кесарева сечения, срочные. Со 2-й недели жизни отмечена плохая прибавка массы тела. В возрасте 4 нед в связи со значительной потерей массы тела и обильными срыгиваниями госпитализирован с подозрением на пилоростеноз. При обследовании выявлены гиперкалиемия (8,2 ммоль/л) и гипонатриемия (109 ммоль/л), снижение уровня сывороточного кортизола (170 нмоль/л) и незначительное повышение уровня 17OHP (9,1 нмоль/л при норме до 6,2 нмоль/л). На основании полученных данных диагностирована сольтеряющая форма ВДКН и начата терапия глюко- (кортеф) и минералокортикоидами (кортинефф). На фоне заместительной гормональной терапии достигнуты прибавка массы тела, нормализация уровня электролитов. В процессе динамического наблюдения уровни 17OHP были всегда снижены, даже на фоне декомпенсации заболевания и значительного повышения уровня АКТГ. Последнее заставило усомниться в правомочности диагноза ВДКН и была предположена ВГН. Обследован в ЭНЦ в возрасте 5 лет (лечение: кортеф2,5 мг/сут, кортинефф 0,05 мг/сут): рост 109 см (SDS 0,16), масса тела 19 кг; Таннер 1, яички 2 мл. При исследовании гена NR0B1 выявлена гемизиготная нонсенс-мутация: замена основания C на G в позиции 1140, что приводило к замене кодона тирозина (TAC) на стоп-кодон (TAG) в позиции 380 (p.Y380X).

№10. Ребенок от первой беременности. Наследственность по материнской линии отягощена: в 2 поколениях отмечалась смерть мальчиков в младенческом возрасте, которой предшествовала прогрессирующая потеря массы тела. У данного больного ухудшение состояния отмечено в возрасте 3 нед, когда появились обильная рвота, потеря массы тела. При госпитализации по месту жительства выявлены гиперкалиемия (7,6 ммоль/л), гипонатриемия (129 ммоль/л) и повышение уровня тестостерона сыворотки (8,8 нмоль/л). Диагностирована ВДКН, назначено лечение глюко- (преднизолон) и минералокортикоидами (флоринеф). С 1,5 лет отмечено увеличение размеров наружных гениталий. Обследован в ЭНЦ в возрасте 2,5 лет (лечение: преднизолон 5 мг/сут, кортинефф 0,075 мг/сут): рост 82,8 см (SDS —2,1), масса тела 11,6 кг; Таннер P1G2, яички 5 мл. При обследовании выявлено умеренное повышение уровня тестостерона (4,8 нмоль/л при норме до 2,8 нмоль/л) при нормальном базальном (1,8 нмоль/л) и стимулированном АКТГ (0,7 нмоль/л) уровне 17OHP и определяемых уровнях ЛГ (2,9 МЕ/л) и ФСГ (1,0 МЕ/л) на фоне стимуляции аналогом ЛГ-рилизинг-гормона. С учетом семейного анамнеза предположена ВГН. При исследовании гена NR0B1 выявлена гемизиготная миссенс-мутация: замена основания T на G в позиции 884, что приводило к замене кодона лейцина (CTC) на аргинин (CGC) в позиции 295 (p.L295R).

Обсуждение

Первое описание ВГН было сделано в 1948 г. чешским патологоанатомом H. Sikl, опубликовавшего результаты вскрытия 33-дневного ребенка, который умер от надпочечниковой недостаточности [2]. L. Weiss и R. Mellinger в 1970 г. представили убедительные доказательства существования X-сцепленного варианта ВГН описав случаи первичной надпочечниковой недостаточности у 3 из 4 братьев, у каждого из которых были разные отцы. Гистологически у этих больных надпочечники были гипоплазированы, не имели четкого разграничения на зоны и были представлены скоплениями крупных слабоокрашенных клеток [3]. Такие клетки, напоминающие клетки фетальной коры надпочечников, но превосходящие их по размеру, являются типичными именно для X-сцепленной формы ВГН, которую морфологически было принято описывать как «цитомегальная» форма [4].

Открытию гена, отвечающего за развитие ВГН, предшествовал ряд исследований, проведенных у больных, клинические проявления ВГН, у которых сочетались с проявлениями некоторых других X-сцепленных заболеваний, таких как мышечная дистрофия Дюшенна [5], дефицит глицеролкиназы [6] и дефицит карбомоилтрансферазы [7]. В некоторых случаях наблюдались проявления 3 заболеваний одновременно [8, 9]. Было высказано предположение, что такие сочетания, именуемые синдромом генных последовательностей, являются следствием дефектов обширных участков X-хромосомы, затрагивающие несколько генов, включая ген ВГН. М. Stuhrmann и соавт. при обследовании 2-летнего ребенка с ВГН в сочетании с мышечной дистрофией Дюшенна и дефицитом глицеролкиназы выявили микроделецию в области Xp21, что позволило картировать на данном участке X-хромосомы гены, отвечающие за развитие этих 3 заболеваний [9]. Е. Zanaria и соавт. при проведении скрининга связанных с геномной областью Xp21 библиотек кДНК ткани яичек и фетальных надпочечников изолировали ген-кандидат ВГН [10]. Одновременно той же группой ученых было показано, что дупликация данной области X-хромосомы при мужском кариотипе приводит к реверсии женского пола — феномену, названному дозозависимой реверсией пола (dosage sensitive sex reversal, DSS) [11]. Новый ген, таким образом, получил название DAX1, сокращенно от DSS, adrenal hypoplasia congenita — врожденная гипоплазия надпочечников, X-хромосома, ген 1 [10].

Ген состоит из 2 экзонов, охватывает геномную область около 5 тыс. пар нуклеотидов и кодирует белок, насчитывающий 270 аминокислотных остатков. Кодируемый белок DAX1 по структуре представляет собой ядерный рецептор [10], что послужило причиной для появления другого названия гена, который по новой номенклатуре называется NR0B1, сокращение от (Nuclear Receptor subfamily 0, group B, member 1 — ядерный рецептор, подсемейство 0, группа B, член 1). Несмотря на то что DAX1 является рецептором, лиганд для него еще неизвестен.

Функция белка DAX1 полностью не выяснена. Известно, что у плода белок экспрессируется в корковом веществе надпочечников, гонадах, гипоталамусе и аденогипофизе, у взрослых — в корковом веществе надпочечников, яичках (клетки Сертоли и клетки Лейдига), текальных, гранулезных и интерстициальных клетках яичников, гонадотрофах гипофиза и вентромедиальном ядре гипоталамуса [12]. В соответствии с современными представлениями DAX1 является корегулятором, что осуществляется как на уровне транскрипции [13], так и при прямом взаимодействии с другими белками [14]. До недавнего времени считалось, что DAX1 действует исключительно как репрессор, как это было доказано в эксперименте в отношении ряда ядерных рецепторов [15—17]. Между тем к настоящему времени получены данные, что DAX1 может выполнять и функцию активатора, как было показано в отношении регуляции транскрипции 11β-гидроксилазы (CYP11B1) [18]. В одном из последних исследований было также показано участие DAX1 наряду с другими транскрипционными факторами в регуляторном каскаде, определяющем плюрипотентность эмбриональных стволовых клеток [19]. Такие разнонаправленные функции белка-корегулятора и его дифференцированная экспрессия в различные периоды онтогенеза, по-видимому, и определяют значительную гетерогенность клинических проявлений ВГН.

Первые мутации в гене NR0B1 у больных с ВГН были выявлены F. Muscatelli и соавт. [20]. Авторами были обнаружены как делеции гена (у больных с изолированной ВГН, ВГН в сочетании с дефицитом глицеролкиназы или ВГН в сочетании с дефицитом глицеролкиназы и мышечной дистрофией Дюшенна), так и точковые мутации [20]. До настоящей публикации было описано более 130 мутаций в гене NR0B1. Среди идентифицированных нами у больных ВГН 9 мутаций 7 являются новыми.

Распространенность ВГН точно неизвестна. В публикации С. Laverty и соавт., основанной на аутопсийных данных и учитывающей все формы заболевания, приведена распространенность гипоплазии надпочечников (всех форм) 1:12 500 новорожденных [21]. Другие авторы считают, что эта цифра является завышенной, и частота развития ВГН (по крайней мере, ее X-сцепленного варианта) должна быть в несколько раз ниже, чем при ВДКН вследствие дефицита 21-гидроксилазы [22]. L. Lin и соавт. предположили, что распространенность X-сцепленного варианта ВГН составляет от 1:70 000 до 1:600 000 мальчиков [23]. По нашим наблюдениям, в структуре врожденного гипокортицизма у мальчиков дефект фактора DAX1 встречается как минимум в 10 раз реже, чем сольтеряющая форма дефицита 21-гидроксилазы.

Типично ВГН манифестирует на первом месяце жизни симптомами первичной надпочечниковой недостаточности с потерей соли. Отмечаются снижение аппетита, частые срыгивания, рвота, плохая прибавка массы тела, гиперпигментация, снижение тургора тканей. При лабораторном исследовании определяются гипонатриемия, гиперкалиемия, метаболический ацидоз и гипогликемия. У 2 обследованных нами больных, помимо симптомов потери соли, отмечались судорожные приступы, что, по-видимому, было проявлением гипогликемии. Следует подчеркнуть, что точно такие же клинические и биохимические проявления заболевания отмечают у мальчиков с сольтеряющей формой дефицита 21-гидроксилазы, и не случайно, что у 5 из 6 наших пациентов с манифестацией ВГН в раннем возрасте первоначально была диагностирована ВДКН (№1, №7—10). Несмотря на врожденный характер заболевания, возраст манифестации надпочечниковой недостаточности, как видно из представленных нами данных, может в значительной степени варьировать. У 2 из 10 больных явные проявления надпочечниковой недостаточности были отмечены после 10 лет. Не исключено, однако, что скрытые симптомы гипокортицизма имелись задолго до манифестации. Так, у одного из больных уже с раннего возраста были отмечены низкие темпы роста, что могло быть проявлением хронического синдрома потери соли. В литературе есть описания еще более поздней манифестации ВГН. А. Tabarin и соавт. диагностировали ВГН у 28-летнего мужчины, у которого в течение 5 лет до этого отмечались жалобы на слабость, а за год до обследования появились эпизодические рвоты, боли в животе, ортостатическая гипотония и снижение массы тела [24]. Обследование подтвердило полное отсутствие секреции глюко- и минералокортикоидов при умеренном снижении базального уровня тестостерона и сохранной реакции гонадотропинов в ответ на стимуляцию ЛГ-рилизинг-гормоном, что было расценено как «позднее начало надпочечниковой недостаточности и парциальный гипогонадизм» [24]. Следует отметить, что проявления надпочечниковой недостаточности при ВГН также могут варьировать. А. Verrijn Stuart и соавт. описали случай заболевания, протекавшего в форме изолированного дефицита минералокортикоидов [18].

Сочетание ВГН и гипогонадотропного гипогонадизма было впервые отмечено А. Prader и соавт., которые подтвердили недостаточность ЛГ у самого старшего из наблюдаемых ими пациентов с врожденным гипокортицизмом, которому на тот момент было 18 лет [25]. В последующем ассоциация гипогонадотропного гипогонадизма и ВГН была признана типичной для данного заболевания [26, 27]. Проявлением врожденного гипогонадотропного гипогонадизма, которое при ВГН может быть документировано уже при рождении, является крипторхизм. Среди 10 наших больных крипторхизм отмечался у 2.

Следует отметить, что у одного из наблюдавшихся нами пациентов не только нельзя было обсуждать наличие врожденного гипогонадизма, но и, наоборот, имелись признаки преждевременного полового развития (ППР). У этого мальчика (№10) с 3-недельного возраста отмечались проявления гипокортицизма (на основании чего была диагностирована ВДКН), а с 1,5 лет отмечено увеличение наружных гениталий (что также было расценено как проявление ВДКН). При обследовании, несмотря на низкие уровни 17OHP, уровень тестостерона был повышен, что свидетельствовало о тестикулярном источнике андрогенов. Дальнейшего прогрессирования ППР не отмечалось. Причина данного феномена неизвестна. Возможно, что выявленная у этого пациента миссенс-мутация гена NR0B1 (L295R) была причиной специфического изменения функции фактора DAX1 и транзиторной активации клеток Лейдига. Показано, например, что у мышей с нокаутированным геном Ahch (гомолог NR0B1) имеется гиперплазия клеток Лейдига [28]. Сходный с этим случай ВГН описан S. Domenice и соавт. [29], по мнению которых гиперфункция клеток Лейдига у представленного ими пациента была зависимой от АКТГ. Пока неизвестно, каково будет половое развитие у нашего пациента с гонадотропиннезависимым ППР. У всех наблюдавшихся нами больных, которые уже достигли пубертатного возраста, отсутствовали признаки спонтанного полового развития, и по достижении 16 лет во всех случаях нами был диагностирован гипогонадотропный гипогонадизм.

У всех представленных в настоящей публикации больных диагноз был подтвержден результатами молекулярно-генетических исследований — выявлены дефекты гена NR0B1. Как и в других статьях, в которых проводился анализ дефектов гена NR0B1 при ВГН [30, 31], большинство из обнаруженных нами точковых мутаций локализовались в области 3’ экзона 2, что в транслируемом белке соответствовало лигандсвязывающему домену DAX1. Лишь 2 из 12 мутаций локализовались в ДНК-связывающем домене белка. Так как большинство выявленных дефектов представляли собой нонсенс-мутации или мутации со сдвигом рамки считывания, о какой-либо четкой корреляции генотипа и клинических проявлений ВГН у наших пациентов говорить сложно. Между тем во всех случаях с манифестацией заболевания после года мутации приводили к относительно незначительным изменениям белка. Так, у пациента №5 мутация c.1326delT приводила лишь к незначительному укорочению C-концевой области белка DAX1, у которого оставались неизмененными первые 441 из 470 аминокислот. У больного №6 была обнаружена миссенс-мутация, приведшая к замене одного нейтрального остатка другим (Q283P). Особый интерес представляет мутация c.129C>A (пациенты №3 и №4). В этом случае локализующаяся в самом начале кодирующей последовательности нонсенс-мутация С43Х, казалось бы, должна была привести к полной потери функции, что не согласуется с «мягким» фенотипом заболевания. Объяснение этому феномену нашли G. Ozisik и соавт. [32], исследовавшие мутацию Q37X, которая была также выявлена у пациента с поздней манифестацией ВГН. Как было показано in vitro, DAX1 может транслироваться в этой же рамке считывания при использовании альтернативного инициализирующего кодона — метионина в позиции 83, результатом чего является укорочение белка до 388 аминокислотных остатков за счет N-конца [32]. По-видимому, использование такого же места инициализации трансляции происходит и в случае выявленной нами мутации C43X.

Таким образом, представленный материал является первым в отечественной литературе обобщением случаев ВГН и подчеркивает полиморфизм клинических проявлений заболевания, которое, несмотря на наследственный характер патологии, может манифестировать не только у новорожденных, но и у детей старшего возраста и должно быть включено в алгоритм дифференциальной диагностики гипокортицизма и гипогонадизма у мальчиков и молодых мужчин.

Подтверждение e-mail

На test@yandex.ru отправлено письмо с ссылкой для подтверждения e-mail. Перейдите по ссылке из письма, чтобы завершить регистрацию на сайте.

Подтверждение e-mail