Сайт издательства «Медиа Сфера»
содержит материалы, предназначенные исключительно для работников здравоохранения. Закрывая это сообщение, Вы подтверждаете, что являетесь дипломированным медицинским работником или студентом медицинского образовательного учреждения.

Штандель С.А.

ГУ «Институт проблем эндокринной патологии им. В.Я. Данилевского» НАМН Украины, Харьков

Тихонова Т.М.

ГУ «Институт проблем эндокринной патологии им. В.Я. Данилевского» НАМН Украины, Харьков

Особенности наследственной предрасположенности к медленно прогрессирующему аутоиммунному диабету взрослых

Авторы:

Штандель С.А., Тихонова Т.М.

Подробнее об авторах

Журнал: Проблемы эндокринологии. 2015;61(5): 30‑42

Просмотров: 361

Загрузок: 3

Как цитировать:

Штандель С.А., Тихонова Т.М. Особенности наследственной предрасположенности к медленно прогрессирующему аутоиммунному диабету взрослых. Проблемы эндокринологии. 2015;61(5):30‑42.
Shtandel SA, Tikhonova TM. The hereditary predisposition features of latent autoimmune diabetes of adults. Problemy Endokrinologii. 2015;61(5):30‑42. (In Russ.).

?>

Многочисленные работы по изучению гетерогенности сахарного диабета (СД) явились основанием для выделения в качестве подтипа СД 1-го типа (СД1) медленно прогрессирующего аутоиммунного СД взрослых (МПАДВ) [1]. Исходя из предположения, что в основе развития СД1 и МПАДВ лежат различные патогенетические процессы, общими для которых являются аутоиммунные нарушения, а клиническая манифестация МПАДВ протекает аналогично СД2, предлагалось введение термина СД1,5 типа [2]. К. Hamaguchi и соавт. [2] оставляют открытым вопрос о том, является ли заболевание у этих пациентов отдельной формой СД, либо имеет место СД1 с поздней манифестацией. На долю МПАДВ приходятся 2—12% всех случаев СД и 10—20% случаев СД взрослых [3]. Исследования МПАДВ были инициированы эпидемиологическими данными, согласно которым среди больных СД2 обнаруживается неожиданно высокий процент пациентов (14,3%) с наличием аутоантител к декарбоксилазе глутаминовой кислоты (GAD); в последующем таких больных приходится переводить на инсулинотерапию [4]. Дебют МПАДВ наблюдается преимущественно в возрасте от 35 до 50 лет. Торпидная манифестация данной формы СД с отсутствием специфических диабетических жалоб и возможностью достижения компенсации на первых порах путем назначения диеты и пероральных сахароснижающих препаратов обусловлена значительно менее агрессивной по сравнению с классическим СД1 деструкцией β-клеток и сохраняющейся вначале их секреторной активностью. Это определяет сходство манифестации МПАДВ с СД2 [5]. По мере развития патологического процесса (в среднем от 6 мес до 5 лет после диагностирования СД) на фоне пероральной сахароснижающей терапии ухудшаются показатели гликемического контроля и возникает необходимость в переводе больных на инсулин [1]. С учетом основного механизма поражения β-клеток верификация диагноза МПАДВ основана на выявлении аутоантител к GAD (GAD ab), цитоплазматическому антигену (ICA ab), тирозинфосфатазе (IA—2A ab), инсулину (IAA ab) [2]. В отличие от СД1 при МПАДВ может наблюдаться иммунотолерантность к антигенам β-клеток, что способствует спонтанной защите клеток поджелудочной железы от обширной Т-клеточной деструкции [5]. Несмотря на выявление при МПАДВ генотипов HLA-системы, свидетельствующих о высоком риске развития СД, некоторые исследователи придают им меньшее значение, чем при СД1 [6]. Обследования пациентов с установленным диагнозом СД2 и наличием аутоантител к GAD показали, что эта форма СД имеет аутоиммунную природу, но отличается от СД1 по инсулинозависимости и распределению предрасполагающих к СД аллелей [2]. Изучение семейного накопления разных форм СД у больных с МПАДВ выявило присутствие родственников I и II степени родства, больных как СД1, так и СД2 [7]. Таким образом, к настоящему моменту вопрос о генетической детерминации этой формы СД остается открытым.

Установлено влияние структуры популяции на распространенность наследственных заболеваний [8]. «Генетический груз» популяции состоит из двух компонентов — мутационный и сегрегационный груз, связанный с полиморфизмом генов. В оптимальной среде разные генотипы не отличаются по жизнеспособности от полиморфной части генома. В субоптимальной, стрессирующей среде разные генотипы начинают вести себя по-разному. Гетерозиготы, у которых ген представлен разными аллелями, лучше приспосабливаются к изменениям окружающей среды, чем гомозиготы, поэтому гетерозиготность популяции возрастает, «сегрегационный груз» накапливается. К факторам, изменяющим генные частоты в популяции, относят (наряду с мутациями и отбором) миграцию, изоляцию и аутбридинг [9]. Под аутбридингом в современных популяциях человека подразумевается расширение круга брачных связей (увеличение среднего расстояния между местами рождения мужа и жены), увеличение частоты межнациональных браков [8]. Параметром, отражающим степень генетических различий между брачными партнерами, следовательно, и уровень аутбридинга, является расстояние между местами рождения супругов. Показано влияние структуры популяции на подверженность СД [10]. На сегодняшний день доказано полигенное наследование СД1 и СД2 и известен ряд генов, определяющих предрасположенность к развитию этих заболеваний [11, 12]. С учетом особенностей генеза МПАДВ целесообразным является изучение как полиморфизма генов, кодирующих механизмы регуляции иммунной системы, в частности, ее Т-клеточного звена, так и отвечающих за развитие инсулиновой недостаточности. К указанным генам относят ген CTLA4 (cytotoxic T-lymphocyte associated antigen-4), полиморфизм которого определяет также предрасположенность к СД1. Ген CTLA4 расположен на хромосоме 2q33 между двумя генами-активаторами Т-лимфоцитов: геном рецептора-активатора (CD28) и геном, индуцирующим костимулятор (ICOS); содержит 4 экзона и три интрона. Изоформа рецептора (full-length isoform — flctla4), синтезируемая в активированных Т-лимфоцитах, закодирована в 4 экзонах: лидерный белок кодируется экзоном 1, лиганд-связывающий домен — экзоном 2, трансмембранная область — экзоном 3 и цитоплазматический домен — экзоном 4. Известно более 30 точечных однонуклеотидных замен в разных районах гена CTLA4. Одной из важных однонуклеотидных замен является полиморфизм одиночного нуклеотида 49A/G в первом экзоне, приводящий к снижению функциональной активности белка CTLA4. Белковый продукт гена CTLA4 принимает участие в регуляции активности Т-лимфоцитов и играет важную роль в развитии аутоиммунных процессов [13]. Доказано участие локуса гена PTPN22 в отрицательном контроле активации и развития Т-лимфоцитов. Ген PTPN22 (protein tyrosine phosphatase non-receptor type 22) картирован на 1p13.3—p13.1 хромосоме. Он кодирует лимфоид-специфическую фосфатазу LYP, супрессирующую активацию Т-лимфоцитов. Полиморфизм С1858Т обусловливает замену аргинина на триптофан в 620 кодоне SH3-области белка. Два варианта гена PTPN22 – С1858 и Т1858 — различаются важной частью аминокислотной последовательности, отвечающей за ассоциацию LYP с Csk-киназой (негативная регуляция). При замене аргинина на триптофан в 620 положении (аллель Т1858) не обеспечивается связь с Csk-киназой. Это и определяет склонность к аутоиммунным заболеваниям, в частности, к СД1 [14]. Показана также [13] ассоциация СД1 с полиморфизмом 49A/G гена CTLA4. Ген KCNJ11 находится на 11 хромосоме в области р15.1. Этот ген кодирует синтез белка Kir6.2 (Potassium inward rectifier 6.2), входящего в состав калиевого канала в клетках, способных к возбуждению, и создает поры для транспортировки ионов калия. Закрытие канала необходимо для секреции инсулина β-клетками. Большинство мутаций этого гена являются миссенс-мутациями, имеющими доминант-негативный эффект, приводящий к снижению тока ІК1, уменьшению реполяризации и увеличению длительности потенциала действия. Этот полиморфизм принимает участие в развитии инсулиновой недостаточности у больных СД2 и ассоциирован с его развитием во многих популяциях [15].

Цель настоящего исследования — комплексный анализ наследственной предрасположенности к развитию МПАДВ с использованием генеалогического, генетико-демографического и молекулярно-генетического методов.

Материал и методы

Семейное накопление СД и степень метизации (СМ) МПАДВ, СД1 и СД2 у родственников I и II степени родства было изучено у 1056 пациентов (98 — МПАДВ, 451 — СД1 и 507 — СД2), находившихся на лечении в клинике ГУ ИПЭП. Характеристика пациентов представлена в табл. 1.

Таблица 1. Характеристика больных СД Примечание. Х‾ — среднее арифметическое; mХ‾ — ошибка среднего.

МПАДВ диагностировался на основании торпидной манифестации заболевания, отсутствия спокойной и/или продолжительной компенсации на фоне приема пероральной сахароснижающей терапии. Диагноз подтверждался при показателях С-пептида (менее 0,56 нг/мл), положительного титра антител к GAD, ICA и IA—2A.

Сбор данных генеалогического анамнеза проводился методом единичной регистрации согласно рекомендациям ВОЗ [16]. Фенотипы родственников устанавливались путем анкетирования и обследования врачами клиники. Распространенность форм СД в Харькове рассчитана по данным историй болезни, имеющихся в районных поликлиниках, а также сведений об общей численности населения города. Влияние генетических и средовых факторов определялось путем компонентного анализа. Исследование генетической гетерогенности заболевания проводилось по методу Ch. Smith [17].

СМ больного определялась согласно [18]. Больные распределялись в четыре группы в соответствии с данными о месте рождения и национальности родителей и прародителей. 1-ю группу составили индивиды, родители которых были одной национальности и происходили из одного небольшого населенного пункта. Во 2-й группе родители пробандов были одной национальности, но родились в разных населенных пунктах, либо одном большом городе. 3-ю группу составили лица, родители которых были разных, этнически близких национальностей (русские и украинцы). В 4-ю группу вошли больные, родители и прародители которых были разных этнически отдаленных национальностей (русские и казахи).

Определение полиморфизма С1858Т гена PTPN22 проведено у 62 больных СД1, у 131 пациента с СД2, у 110 лиц с LADA и 11 здоровых жителей Харькова. Сведения о полиморфизме С1858Т гена PTPN22 у 242 здоровых жителей Харькова и 296 больных СД1, полученные в 2004 г., были любезно предоставлены для дальнейшего анализа научным сотрудником Института паразитологии и биомедицины Федец Марией Ивановной (Гранада, Испания). Авторы выражают ей глубокую благодарность за предоставленные данные. Определение полиморфизма 49A/G гена CTLA4 выполнено у 64 больных СД1, 127 пациентов с СД2, 109 лиц с LADA и 44 здоровых жителей Харькова. Определение полиморфизма Е23К гена KCNJ11 проводилось у 47 больных СД1, 101 пациентов с СД2, 83 лиц с LADA и 44 здоровых жителей Харькова.

Полиморфизм С1858Т гена PTPN22 определялся при помощи полимеразной цепной реакции с использованием rsaI рестриктазы [14]. Полиморфизм С1858Т гена PTPN22 был амплифицирован при помощи прямого ACTGATAATGTTGCTTCAACGG и обратного TCACCAGCTTCCTCAACCAC праймеров. Реакционная смесь содержала 20 нг геномной ДНК, 1,2 мкл 10x PCR буфера, 1,2 мкл dNTP (1,25 ммоль/л), 0,3 мкл каждого праймера (20 пмоль/л), 0,6 мкл DMSO и 0,1 мкл Taq полимеразы (фирма «Сибэнзим») в 12 мкл реакционной смеси. Условия амплификации: первоначальная денатурация 2 мин при 94 °C, последующие шаги — 94 °C, 30 с, 30 с в 60 °C и 30 с в 72 °C (35 циклов), и 1 цикл — 72 °C 2 мин. Продукт амплификации (12 мкл) инкубировался с 10 U rsaI рестриктазы (фирмы «Сибэнзим») при температуре 37 °C в течение 12 ч. Мутантный аллель 1858 Т теряет последовательность рестрикции и состоит из фрагмента 218 bp. Рестрикция аллеля 1858С дает фрагменты 176 bp и 46 bp.

Полиморфизм A49G гена CTLA4 амплифицирован при помощи прямого GCTCTACTTCCTGAA GACCT и обратного AGTCTCACTCACCTTTGCAG праймеров. Реакционная смесь содержала 25 нг геномной ДНК, 2,5 мкл 10х PCR буфера, 0,6 мкл dntp (2,5 ммоль/л), 0,3 мкл каждого праймера (20 пмоль/л), и 0,2 мкл Taq полимеразы (фирма «Сибэнзим») в 25 мкл реакционной смеси. Условия амплификации: первоначальная денатурация 4 мин при 94 °C, последующие шаги: 58 °C, 45 с, 45 с в 72 °C, и 45 с в 94 °C (30 циклов), и окончательная экспозиция при 72 °C 4 мин. Продукт амплификации (10 мкл) инкубировался с рестриктазой bbvi при 65 °C в течение 1 ч. Нормальный аллель 49 А теряет последовательность рестрикции, состоит из фрагмента 162 bp, рестрикция мутантного аллеля 49G дает фрагменты 88 bp и 74 bp [13].

Полиморфизм Е23К гена KCNJ11 был амплифицирован при помощи прямого GAATACGTCCTGA CACGCCT и обратного GCCAGCTGCACAGGAA GGACAT праймеров. Реакционная смесь содержала 25 нг геномной ДНК, 2,5 мкл 10х PCR буфера, 0,6 мкл dntp (2,5 ммоль/л), 0,3 мкл каждого праймера (20 пмоль/л), и 0,3 мкл Taq полимеразы (фирма «Сибэнзим») в 25 мкл реакционной смеси. Условия амплификации: первоначальная денатурация 3 мин при 95 °C, последующие шаги — 95 °C 1 мин, 1 мин в 62 °C, и 1 мин в 72 °C (35 циклов) и окончательная экспозиция при 72 °C 5 мин. Продукт амплификации (10 мкл) инкубировался с рестриктазой BanII при 37 °C в течение 2 ч и при 65 °C 10 мин. Мутантный аллель 23К теряет последовательность рестрикции и состоит из фрагмента 218 bp. Рестрикция аллеля 23Е дает фрагменты 178 bp и 40 bp [15].

Оценка относительного риска развития заболевания при носительстве полиморфизма (Odds ratio) проводилась согласно [19].

Влияние СМ на подверженность всем формам СД оценивалась при помощи однофакторного дисперсионного анализа, достоверность различий определялась при помощи критерия χ2 [20].

Комиссия по вопросам этики ГУ «ИПЭП им. В.Я. Данилевского НАМН Украины» (протокол № 10 от 26.06.14) свидетельствует, что участники исследования подписывали информированное согласие; протоколы исследований соответствуют морально-этическим нормам и принципам Хельсинкской декларации, Конвенции Совета Европы и соответствующих законов Украины по соблюдению прав человека.

Результаты и обсуждение

Исходные данные, послужившие основой для генетического анализа, представлены в табл. 2. Полученные данные свидетельствуют о значительном преобладании родителей, больных СД1, СД2 и МПАДВ по сравнению с их популяционными частотами.

Таблица 2. Распространенность МПАДВ среди родственников пробандов и в популяции

Так как генетическая детерминация СД описывается параметрами модели D. Falconer [11], для изучения взаимосвязи между подверженностями к МПАДВ, СД1 и СД2 была тестирована модель генетической гетерогенности Ch. Smith (табл. 3). Эта модель применяется для выяснения генетической гетерогенности клинических форм исследуемого заболевания, в случае, если показано его полигенное наследование, описываемое пороговой моделью D. Falconer.

Таблица 3. Анализ взаимосвязи между подверженностями к различным клиническим формам СД

На основе данных семейного анамнеза были рассчитаны прямые и перекрестные коэффициенты корреляции в парах «пробанд—родитель». В модели Ch. Smith, предполагающей существование различных подверженностей к двум формам заболевания, коэффициент корреляции между подверженностями (rg) к МПАДВ и СД1 составил 0,653±0,096, а к МПАДВ и СД2 — 0,661±0,068. Это указывает на генетическую самостоятельность сравниваемых форм и значительное число общих генов в детерминации клинических вариантов заболевания. По результатам проведенного анализа выполнено тестирование распределения МПАДВ среди родственников и в популяции на предмет их соответствия параметрам пороговой модели D. Falconer. Представленные данные показали соответствие распределения больных среди родственников пробанда и в популяции параметрам этой модели. При разложении общей фенотипической дисперсии подверженности к МПАДВ, с использованием данных о родителях и сибсах, подходящим оказалось решение, включающее оценку GA=(57,62±15,17%) и GD=(12,16±43,56%). Оценка GA в данном решении могла быть теоретически завышена за счет входящих в нее ½ оценки эпистатической генетической компоненты и удвоенной оценки систематической средовой компоненты «общего дома». В рамках этой модели весомый вклад в развитие МПАДВ вносят генетические факторы (коэффициент наследования в «узком смысле» составил 59,2%).

Таким образом, помимо того, что в детерминации МПАДВ генетические факторы играют существенную роль, существуют нелинейных межаллельные взаимодействия в системе генетического контроля заболевания (GD).

Влияние структуры популяции на подверженность МПАДВ изучалось путем исследования особенностей семейного накопления СД1 и СД2 в зависимости от СМ больного. Полученные результаты свидетельствуют о том, что распределение больных МПАДВ по СМ достоверно не отличается от такового в популяции (χ2=2,917; df=3; р=0,549). Не выявлено взаимосвязи СМ и семейного накопления СД1 среди родственников I и II степени родства у больных разной С.М. Однако была показана значимость влияния СМ на семейное накопление СД2 среди родственников I и II степени родства у больных МПАДВ (табл. 4).

Таблица 4. Результаты однофакторного дисперсионного анализа семейного накопления СД1 среди родственников I и II степени родства у больных МПАДВ разной СМ

Особенности семейного накопления СД среди родственников I и II степени родства у больных разными формами СД различной СМ приведены в табл. 5.

Таблица 5. Больные С.Д. родственники I и II степени родства у пациентов с СД разной СМ

Анализ семейного накопления СД у больных разной СМ показывает увеличение семейного накопления СД1 среди родственников I и II степени родства с ростом СМ у пробандов с СД1 (0,82—1,87—1,91—4,51% соответственно) при приблизительно одинаковом семейном накоплении СД2 (3,84—3,39—3,74—2,66% соответственно).

Среди больных СД2 увеличение СМ пробанда сопровождалось увеличением семейного накопления СД2 у родственников I и II степени родства у пациентов 2 и 4 — СМ (5,14—7,30—5,73—7,90% соответственно), тогда как накопление СД1 в родословных было несколько большим у больных 4 СМ, чем в остальных группах (1,33—1,55—1,13—2,82% соответственно).

У больных МПАДВ среди родственников I и II степени родства отмечался рост семейного накопления СД1 с 1 по 3 СМ и его снижение у больных 4 СМ (0,71—1,94—2,21—0,00% соответственно), что отличалось от такового при СД1 и СД2; больные 1 СМ характеризовались значимо более низким семейным накоплением СД2 среди родственников I и II степени родства (1,79—6,78—6,27—6,33% соответственно), что также отличается от такового у больных СД1 и СД2.

Проведенный анализ показал влияние СМ больного на семейное накопление СД у больных СД1, СД2 и МПАДВ, что подтверждает генетическую самостоятельность МПАДВ, доказанную нами ранее путем генетического анализа.

Учитывая то, что современный уровень исследований использует не только данные генетического анализа, но и методы молекулярной генетики, нами были изучены особенности распределения единичных нуклеотидных полиморфизмов генов, определяющих предрасположенность как к СД1, так и к СД2.

Результаты генетического анализа показали большой процент общих генов как СД1, так и СД2 в детерминации МПАДВ. Исходя из того, что антигены системы HLA, определяющие в основном предрасположенность к СД1, сильно сцеплены и плохо комбинируются, целесообразно было изучить полиморфизмы генов иммунного ответа, играющих вторичную роль в развитии СД1, локализованных на разных хромосомах и хорошо комбинирующихся в популяции в процессе скрещивания.

В качестве примера таких полиморфизмов изучались распределение С1858Т гена PTPN22 и 49A/G гена CTLA4 у больных СД1, СД2, МПАДВ и здоровых жителей Харькова. Среди единичных полиморфизмов, определяющих развитие предрасположенности к СД2, логично было исследовать мутацию, отвечающую за развитие инсулиновой недостаточности. К таким мутациям относится полиморфизм Е23К гена KCNJ11.

Сравнительный анализ распределения генотипов полиморфизма С1858Т гена PTPN22 среди всех сравниваемых групп (табл. 6) выявил статистически значимую разницу распределения у здоровых индивидов и больных LADA, СД1 и СД2 (χ2=47,063; р=0,000).

Таблица 6. Частоты генотипов и аллелей полиморфизма С1858Т гена PTPN22 у больных СД и здоровых жителей Харькова

Изучение распределения генотипов С→Т1858Т гена PTPN22 показало значимую ассоциацию гомозигот по этому полиморфизму с МПАДВ, СД1 и СД2. Следует отметить, что среди пациентов с МПАДВ значимо чаще, чем среди больных СД1 или СД2 встречались гомозиготные носители этого полиморфизма. Значимых различий в частотах генотипов между больными СД1 и СД2 не выявлено (табл. 7).

Таблица 7. Различия в частотах генотипов и аллелей полиморфизма С1858Т гена PTPN22 у больных СД

Таким образом, изучение ассоциации единичного нуклеотидного полиморфизма С1858Т гена PTPN22 показало его выраженную ассоциацию с МПАДВ, СД1 и СД2. Наиболее выраженная ассоциация этого полиморфизма наблюдалась с МПАДВ. Для проверки этого предположения нами было изучено распределение полиморфизма 49A/G гена CTLA4, вызывающего иммунные нарушения, у больных разными клиническими вариантами С.Д. Полученные результаты представлены в табл. 8.

Таблица 8. Частоты генотипов и аллелей полиморфизма 49A/G гена CTLA4 у больных СД и здоровых жителей Харькова

Анализ распределения генотипов среди всех сравниваемых групп показал значимое отличие больных СД1, СД2 и МПАДВ от здоровых жителей Харькова (χ2 =17,853; df=6; р=0,001). Показана значимая ассоциация мутантных гомозигот G/G с СД1, СД2 и МПАДВ (ORСД 1 =5,61; ORСД 2а =4,27; ORМПАДВ =7,30). Также следует отметить, что среди больных с МПАДВ достоверно чаще, чем среди больных СД2 встречались гомозиготные носители полиморфизма 49A/G гена CTLA4 (табл. 9).

Таблица 9. Различия в частотах генотипов и аллелей полиморфизма 49A/G гена CTLA4 у больных СД

Достоверных различий в частотах генотипов больных СД1 и СД2 не выявлено. Ассоциации полиморфизма, вызывающего аутоиммунные нарушения с СД1, СД2 и МПАДВ, может быть следствием снижения давления отбора против СД1, который перестал быть сублетальным признаком в результате введения в практику инсулинотерапии.

Результаты сравнительного анализа распределения полиморфизма Е23К гена KCNJ11, участвующего в развитии инсулиновой недостаточности и определяющего предрасположенность к СД2, приведены в табл. 10.

Таблица 10. Частоты генотипов и аллелей полиморфизма Е23К гена KCNJ11 у больных СД и здоровых жителей Харькова

Анализ распределения генотипов Е23К гена KCNJ11 среди сравниваемых групп выявил значительную ассоциацию носителей полиморфных гомозигот с СД1, СД2 и МПАДВ (ORСД 1 =13,10; ORСД 2 =12,88; ORМПАДВ =14,69).

Также следует отметить, что среди больных МПАДВ по сравнению с больными СД1 и СД2 чаще встречались гомозиготные носители мутации Е23К гена KCNJ11. Достоверных различий по частоте генотипов среди больных СД1, СД2 и МПАДВ не выявлено (табл. 11).

Таблица 11. Различия в частотах генотипов и аллелей полиморфизма Е23К гена KCNJ11 у больных СД

На рис. 1 представлено распределение носительства полиморфизмов 49A/G гена CTLA4 и С1858Т гена PTPN22 больными с разными клиническими вариантами СД.

Рис. 1. Распределение полиморфизмов 49A/G гена CTLA4 и С1858Т гена PTPN22 у больных разными клиническими вариантами СД.

Показаны значимые межгрупповые различия распределения по генотипам 49A/G гена CTLA4 и С1858Т гена PTPN222=23,485; df=16; р=0,000). Попарное сравнение вариантов заболевания выявило значимость различий больных МПАДВ и СД 2 (χ2=11,584; df=8; р=0,021). Достоверных различий распределения больных по указанным полиморфизмам между группами МПАДВ и СД1, а также СД1 и СД2 выявлено не было (χ2=4,859; df=8; р=0,302; χ2=4,438; df=8; р=0,350 соответственно). Обнаружена значимо большая частота носительства гомозиготных генотипов GG/TT у больных МПАДВ по сравнению с таковой у больных СД 2 (8,65 и 1,67% соответственно; χ2=4,425; р=0,035).

Распределение больных СД по носительству полиморфизмов 49A/G гена CTLA4 и Е23К гена KCNJ11 приведено на рис. 2.

Рис. 2. Распределение полиморфизмов 49A/G гена CTLA4 и Е23К гена KCNJ11 у больных разными клиническими вариантами СД.

Показаны значимые различия распределения клинических вариантов течения СД по генотипам 49A/G гена CTLA4 и Е23К гена KCNJ11 2=19,978; df=16; р=0,000). Попарное сравнение групп больных СД выявило значимость различий между больными МПАДВ и СД1 (χ2=12,065; df=8; р=0,017); МПАДВ и СД2 (χ2=10,976; df=8; р=0,027). Достоверных различий в распределении больных СД1 и СД2 по вышеуказанным полиморфизмам выявлено не было (χ2=7,859; df=8; р=0,097). Обнаружена значимо большая частота встречаемости носительства гомозиготных генотипов GG/КК у больных МПАДВ по сравнению с таковой у больных СД2 (21,54 и 8,86% соответственно; χ2=3,840; р=0,050).

Показаны достоверные различия распределения больных с разным клиническими вариантами СД по генотипам С1858Т гена PTPN22 и Е23К гена KCNJ11 2=11,146; df=16; р=0,025) (рис. 3). При этом попарное сравнение групп больных не выявило достоверных различий распределения больных МПАДВ и СД2 по вышеуказанным генотипам (χ2=5,233; df=8; р=0,264). Не выявлено значимых различий распределения больных МПАДВ и СД1, а также больных СД1 и СД2 по указанным полиморфизмам (χ2=5,928; df=8; р=0,205; χ2=6,303; df=8; р=0,178 соответственно).

Рис. 3. Распределение полиморфизмов С1858Т гена PTPN22 и Е23К гена KCNJ11 у больных разными клиническими вариантами СД.

Показаны значимые различия в распределении больных разными клиническими вариантами заболевания по генотипам С1858Т гена PTPN22, 49A/G гена CTLA4 и Е23К гена KCNJ11 2=56,923; df=46; р=0,000) (рис. 4). Попарное сравнение групп больных выявило значимые различия в распределении больных по носительству исследуемых полиморфизмов среди всех изучаемых групп: МПАДВ и СД1 (χ2=21,773; df=23; р=0,000); МПАДВ и СД2 (χ2=19,341; df=23; р=0,000); и СД1 и СД2 (χ2=18,588; df=20; р=0,000), что подтверждает генетическую самостоятельность всех этих форм СД.

Рис. 4. Распределение полиморфизмов С1858Т гена PTPN22, 49A/G гена CTLA4 и Е23К гена KCNJ11 у больных разными клиническими вариантами СД.

Однако, если генетическая самостоятельность СД1 и СД2 доказана, причем выделены гены, обусловливающие предрасположенность к этим типам заболевания, то вопрос о генетической детерминации МПАДВ и причинах ее возникновения до настоящего времени открыт. В настоящее время предполагают, что МПАДВ является вариантом течения СД1 [4]. Проведенное нами молекулярно-генетическое исследование выявило генетическую самостоятельность МПАДВ, подтвердив изложенные выше результаты генетического и генетико-демографического анализов.

Отсутствие достоверных различий в изучаемых полиморфизмах у больных СД1 и СД2 полностью соответствуют результатам генетического анализа, свидетельствующего о наличии 59% общих генов в детерминации этих форм СД (см. табл. 3). Учитывая, что СД1 и СД2 являются полигенными заболеваниями, большое значение имеет комбинация генов. Снижение давления отбора против СД1, вызванное внедрением инсулинотерапии, положительная направленность отбора генов предрасположенности к СД2 типа привели не только к увеличению в популяции генов предрасположенности к СД1 и СД2, но и к возрастанию вариантов их комбинирования, что, в частности, и обусловило возникновение МПАДВ.

Заключение

Проведенное комплексное исследование с использованием методов генетического, генетико-демографического и молекулярного анализа выявило генетическую самостоятельность МПАДВ, что может служить основанием для уточнения классификации этой формы С.Д. Полученная модель наследования свидетельствует о том, что МПАДВ является генетически самостоятельной формой СД, описывается параметрами полигенной пороговой модели, в его наследовании существенная роль принадлежит наследственным факторам (57,62%), имеются нелинейные межлокусные и межаллельные (GD=12,16%) взаимодействия и возможно влияние ряда генов с выраженным эффектом. В системе генетического контроля МПАДВ имеет примерно одинаковое количество общих генов с СД1 и СД2 (65,3 и 66,1% соответственно), что определяет особенности вариантов клинического течения этой формы диабета. Семейное накопление СД1 и СД2 среди родственников I и II степени родства больных МПАДВ разной СМ отличается от такового у больных СД1 и СД2. Носительство Е23К гена KCNJ11, 49A/G гена CTLA4 и С1858Т гена PTPN22 в харьковской популяции ассоциировано с МПАДВ, СД1 и СД2. Гомозиготное носительство 23К/К гена KCNJ11, 49G/G гена CTLA4 и 1858Т/Т гена PTPN22 соответствует наибольшему риску развития МПАДВ.

Конфликт интересов отсутствует.

Участие авторов:

Концепция и дизайн исследования — Штандель С.А., Тихонова Т.М.

Сбор и обработка материала — Штандель С.А., Тихонова Т.М.

Статистическая обработка данных — Штандель С.А.

Написание текста — Штандель С.А.

Редактирование — Тихонова Т.М..

Подтверждение e-mail

На test@yandex.ru отправлено письмо с ссылкой для подтверждения e-mail. Перейдите по ссылке из письма, чтобы завершить регистрацию на сайте.

Подтверждение e-mail